ID: 1148722278

View in Genome Browser
Species Human (GRCh38)
Location 17:49762987-49763009
Sequence GAGGGCTACAGTCAAGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722278_1148722292 28 Left 1148722278 17:49762987-49763009 CCATGCACTTGACTGTAGCCCTC 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722278_1148722286 9 Left 1148722278 17:49762987-49763009 CCATGCACTTGACTGTAGCCCTC 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1148722286 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1148722278_1148722287 24 Left 1148722278 17:49762987-49763009 CCATGCACTTGACTGTAGCCCTC 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722278_1148722290 27 Left 1148722278 17:49762987-49763009 CCATGCACTTGACTGTAGCCCTC 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722278_1148722280 -5 Left 1148722278 17:49762987-49763009 CCATGCACTTGACTGTAGCCCTC 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1148722280 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 2
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722278 Original CRISPR GAGGGCTACAGTCAAGTGCA TGG (reversed) Intronic
900122689 1:1055596-1055618 GAGGGATACGGTCACGTCCAGGG - Exonic
900156282 1:1204548-1204570 GAGGGCGTCAGGCCAGTGCAGGG + Intronic
900626688 1:3611669-3611691 GAGGGATACGGGCAAGTACAGGG - Intergenic
904027076 1:27510959-27510981 AAGTGCTACAATCAAGTGGAAGG - Intergenic
904443837 1:30551537-30551559 GAGGTATACAGACAAGTGGAGGG - Intergenic
907427512 1:54389931-54389953 GAGGGATTCAGTCATGGGCAAGG - Intronic
907442949 1:54489647-54489669 GAGGGCCAAAGTCAAGTCCCTGG - Intergenic
907593066 1:55694144-55694166 GTGGGCTACCGGCAAGGGCATGG + Intergenic
907761876 1:57368724-57368746 GAGGTATACAGACAAGTGGAGGG - Intronic
909941665 1:81617972-81617994 GAGGGCTATAACCAAGTGGAAGG - Intronic
917456184 1:175188004-175188026 GAAAGCTATAGTCAAGAGCAAGG + Intronic
920959812 1:210654379-210654401 GAGAGCTACAGTTTAGTGGAGGG - Intronic
921406531 1:214785931-214785953 GATGGCTTCAGACATGTGCATGG - Intergenic
922237679 1:223734129-223734151 CAGCGCTACAGGGAAGTGCAGGG + Intronic
923829929 1:237543592-237543614 AAAGGCTACAGCCAAGTTCAGGG - Intronic
1062771382 10:104369-104391 GAGGTACACAGTCAAGTGGAGGG + Intergenic
1063553485 10:7055624-7055646 AAGGGGGACAATCAAGTGCACGG + Intergenic
1066446253 10:35486517-35486539 GAGGGATAAGGTCAAGGGCAGGG - Intronic
1067715783 10:48690469-48690491 GAGGGATGCAGTCATGTGGAGGG + Intronic
1067817188 10:49489105-49489127 GATGGAAACAGTGAAGTGCAGGG - Intronic
1068348510 10:55814097-55814119 GAGGTATACAGACAAGTGGAGGG - Intergenic
1071692098 10:87831625-87831647 GAGGGAGAGACTCAAGTGCAGGG + Intronic
1071787471 10:88918005-88918027 GAGGGCTCCACTCTAGTGAATGG - Intronic
1076351009 10:129815423-129815445 GAGGGCTGCTGCCAAGAGCAAGG - Intergenic
1077212374 11:1377476-1377498 GAGGGAGTGAGTCAAGTGCATGG + Intergenic
1080497914 11:32838611-32838633 GGGGGCTCCAGTCAGGTGAAGGG + Intronic
1082782316 11:57297555-57297577 GAGGACTACACTGAAATGCAGGG - Intergenic
1083965897 11:66043599-66043621 GAAGGCCACAGTCATGTGCTTGG + Exonic
1084080607 11:66821687-66821709 GAGAGCCACAGTGTAGTGCAAGG + Exonic
1085452934 11:76647814-76647836 GGGAGATACAGGCAAGTGCAAGG + Intergenic
1088989392 11:114938859-114938881 AAGTGCTACAGTCAAGACCAAGG + Intergenic
1089173401 11:116531853-116531875 GAGGGATACGGTCATGTGGAAGG - Intergenic
1089638225 11:119830297-119830319 GAGTGCTACAGAAAGGTGCAAGG - Intergenic
1091439051 12:498408-498430 GAGGGCATCATTCTAGTGCATGG - Intronic
1093936277 12:25004150-25004172 GAGGGCCAAAGTTAAATGCATGG + Intergenic
1096375757 12:51108895-51108917 GAGGGCTAGAGGCAAGAACATGG - Intronic
1099083684 12:78218458-78218480 AAGAGCTAGAGTCAGGTGCATGG + Intergenic
1100585117 12:95972294-95972316 GAGGGTAACACTCAAGGGCATGG - Intergenic
1103057040 12:117829609-117829631 GAGGGCTACAGTCAAGGCCTAGG + Intronic
1109559777 13:64031414-64031436 GAGGGCTACACTTAAGAGCACGG + Intergenic
1111128894 13:83948824-83948846 CCAGGCTACAGTCAACTGCAAGG - Intergenic
1112334981 13:98507248-98507270 GAGGACAACCGTCAGGTGCAGGG + Intronic
1114349521 14:21835216-21835238 GAGGTACACAGTCAAGTGGAGGG + Intergenic
1114959933 14:27873464-27873486 GAGGGCTTCAGTGAAGTCAAAGG - Intergenic
1115650212 14:35397699-35397721 GAGGGAGACAGACAACTGCATGG - Intergenic
1116568500 14:46483979-46484001 GAGAGACACAGTCAAGTGCTAGG - Intergenic
1119180331 14:72600886-72600908 GAGGGCTACAGTCAAGTGGGAGG - Intergenic
1121271645 14:92641718-92641740 AAGGGCCACACTCAAGTTCATGG - Intronic
1121831904 14:97060018-97060040 GAGGCTTACAGTCTAGTGCAGGG - Intergenic
1122884110 14:104702971-104702993 GTGGGCCACAGACAAGTGCCCGG + Intronic
1124594711 15:31082991-31083013 GAGGGGTACAGGAAGGTGCAGGG + Intronic
1128788417 15:70415144-70415166 GAGGGTGACAGGCAAGTGCCTGG + Intergenic
1131999644 15:98165625-98165647 CAGGGCGTCAGTAAAGTGCAAGG + Intergenic
1135174374 16:20215113-20215135 AAGGGCATAAGTCAAGTGCAAGG - Intergenic
1137334262 16:47532888-47532910 GAGGTATGCAGTCAAGTGGAGGG + Intronic
1139183168 16:64771015-64771037 GAGGTCCACAGACAAGTGGAAGG - Intergenic
1139837218 16:69848803-69848825 GAGGGCCACAGGCAAATCCAAGG - Intronic
1140986536 16:80163280-80163302 GAGGTCGACAGTCAAGGGCTTGG + Intergenic
1141944436 16:87299553-87299575 GAGGGCTACAGTGACGGGCCAGG - Intronic
1143033129 17:3978909-3978931 CAGGGCTTCTGTCAATTGCAAGG + Intergenic
1145028281 17:19485823-19485845 GAGGGCCTGAGTCAAGGGCAGGG - Intergenic
1145785147 17:27588671-27588693 GAGGGCTCCAGGTAAGTGCAGGG - Intronic
1146737297 17:35249623-35249645 AAGGGCTACAGTTAAGGGCTGGG - Intronic
1148722278 17:49762987-49763009 GAGGGCTACAGTCAAGTGCATGG - Intronic
1149085549 17:52710815-52710837 GAGGGATACAGACAAGTGGAAGG - Intergenic
1151746726 17:76015509-76015531 GAGGGCTACGGGCAGCTGCAGGG + Exonic
1153598234 18:6751025-6751047 GGAGGCTGCAGTCCAGTGCAGGG - Intronic
1154299698 18:13182387-13182409 GAGGGCTACGGTCACGTGTGTGG + Intergenic
1161173151 19:2823423-2823445 GAGGTATACAGACAAGTGAAGGG + Intronic
1161182420 19:2893256-2893278 GAGAGCTACAGTCAAGAGTGGGG - Intergenic
1163249134 19:16115831-16115853 GAGGGCGAAAGTCCAGTGCTGGG + Intronic
1163898243 19:20078338-20078360 GAGGGCTCCAGGCCAGGGCAGGG - Intronic
1164182609 19:22832594-22832616 GAGGGCTCCAGGCCAGGGCACGG - Intergenic
1166197788 19:41218436-41218458 GTGGGCTACAGGCAAGTGACTGG - Intergenic
1166781023 19:45343227-45343249 GAGTGTCACGGTCAAGTGCAAGG + Intronic
928908340 2:36392171-36392193 GAGTACTACAGTGAAGTGCCAGG - Intronic
936402179 2:112173724-112173746 GTGGCATTCAGTCAAGTGCATGG - Intronic
937508972 2:122571085-122571107 GAGGGCTGCAGGAAAGTGCTGGG - Intergenic
938990451 2:136622969-136622991 GAGGGGTACTGGCAAGAGCAGGG + Intergenic
944034221 2:195274048-195274070 GAGGCCCTCAGTCAAATGCATGG - Intergenic
944416673 2:199486133-199486155 GGGCGCTAAAGTCCAGTGCATGG - Intergenic
946028979 2:216690552-216690574 GAGGGTTACAGCAAAGGGCATGG - Intronic
947949525 2:234135331-234135353 GAAAGCTACAGTCAACTGGATGG - Intergenic
948884059 2:240874254-240874276 GAGGGCTGCAGGCGTGTGCAGGG + Intronic
1170302748 20:14903948-14903970 CAGGGCTACAGTAAACTGCAGGG + Intronic
1170891916 20:20383173-20383195 TGGGGCTGCAGTCAAGTGAAGGG + Intergenic
1173365357 20:42380162-42380184 GAGGGCAACACTGAAGTTCAAGG - Intronic
1173782314 20:45766204-45766226 GAGGGCTCCATTCCAGGGCAGGG + Intronic
1174219826 20:48945402-48945424 CATGGGTACAGTCAAGAGCAGGG - Intronic
1175090780 20:56502089-56502111 GATGGCTTCAGTCAACTGAATGG - Intronic
1180027296 21:45174281-45174303 GAGGGCTACAGTGCCCTGCAAGG - Intronic
949130845 3:498762-498784 GAGTGCTACAATAAAATGCAAGG + Intergenic
949382461 3:3461363-3461385 GAGGGCCGCATACAAGTGCATGG + Intergenic
950932776 3:16807589-16807611 GAGTTCTACAGTCATGGGCAGGG + Intronic
952408598 3:33026917-33026939 GAGGTATACAGACAAGTGGAGGG - Intronic
952494821 3:33906725-33906747 GGGGGCTACAGTAAAGTGTGAGG - Intergenic
953841891 3:46395917-46395939 GCTGGCTCCAGTCAAGTGCTAGG + Intergenic
954759971 3:52866956-52866978 GTGGGCTCCTGTCAGGTGCAGGG + Intronic
965581115 3:170268793-170268815 GATGGCAAAACTCAAGTGCAGGG + Intronic
968448557 4:664429-664451 AAGGGCTACAGACCAATGCAGGG - Intronic
968538588 4:1150649-1150671 GAGGTCTGCAGACAAGTGGAGGG + Intergenic
968877860 4:3283636-3283658 CAGGGCAAGAGTCAGGTGCAGGG + Intergenic
970834105 4:20379984-20380006 GAGGGGTTCAGTCAAGTGTTTGG + Intronic
971318113 4:25584140-25584162 GAGAGCCACAGTCTAGTCCATGG + Intergenic
973589735 4:52428868-52428890 GAGGGCTACAGTGAACGACAGGG + Intergenic
978690240 4:111499809-111499831 AAGGGCTACAGGCAAGGGCTTGG + Intergenic
987685670 5:21197603-21197625 GAGAGCTAGAGTCAAGTACCTGG - Intergenic
994245340 5:97470763-97470785 GAGGTATACAGACAAGTGGAGGG + Intergenic
1001148198 5:169203210-169203232 TAGGACTAAAGTCAAGGGCATGG + Intronic
1004942627 6:20576752-20576774 GGTGGCTACAGTCAAGTGGGAGG - Intronic
1005863823 6:29923357-29923379 GAGGTCTACACTGCAGTGCATGG - Intergenic
1007778800 6:44239311-44239333 GATGGCTGAAGTCATGTGCAAGG - Intergenic
1007996349 6:46312178-46312200 GATGGCAACAGTTAAGTACAAGG + Intronic
1011337100 6:86273477-86273499 GAGAGATACAGCCATGTGCATGG + Intergenic
1013797415 6:113903131-113903153 GAGGTCTACAGTCAATTCCCAGG + Intergenic
1017345151 6:153371233-153371255 GAGGCCCACAGTCAAATTCAGGG + Intergenic
1026359542 7:69591024-69591046 GAGGGATGCAGACAAGTGAAGGG + Intergenic
1032003495 7:128282075-128282097 GGAGGCTGCAGTCAGGTGCATGG + Intergenic
1032798240 7:135296052-135296074 CAGGGCTACAGTAAACAGCATGG + Intergenic
1039019098 8:33185648-33185670 GAGGGATACAAGCAAGTACAGGG + Intergenic
1040525219 8:48216957-48216979 GAAGGCTACAGTCCAGAGTATGG + Intergenic
1043399867 8:79873492-79873514 GAGCGCAGGAGTCAAGTGCACGG - Intergenic
1046931436 8:119845610-119845632 GAGGGCTGCATTAAAATGCATGG + Intronic
1047721436 8:127644000-127644022 GAGGCCTACAGGCTAGTGCAGGG + Intergenic
1053289034 9:36868004-36868026 GAGAGTGACAGTCAAGTGAAAGG + Intronic
1054760453 9:68999909-68999931 AAAGGCTACAATCAAGTACATGG - Intronic
1057468615 9:95338165-95338187 GAGGTATACAGACAAGTGGAGGG - Intergenic
1058561824 9:106237975-106237997 GAGGGCCACAATCCAGTGGAAGG - Intergenic
1060047603 9:120353205-120353227 GAGGGCTACAGTAGAATGGAAGG + Intergenic
1060267902 9:122122826-122122848 GAGGCCTACAGGCGTGTGCAAGG - Intergenic
1197100103 X:122642888-122642910 GATGGCTACAGTGAAATGCAAGG - Intergenic
1198807785 X:140506859-140506881 AAGGGCTGCAGTCAACTGGATGG + Intergenic