ID: 1148722279

View in Genome Browser
Species Human (GRCh38)
Location 17:49763005-49763027
Sequence CCAACGTGGCAGTGGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 180}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722279_1148722287 6 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722279_1148722294 17 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722294 17:49763045-49763067 AAACAGCCTTGGTGGGTAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 391
1148722279_1148722298 24 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722298 17:49763052-49763074 CTTGGTGGGTAGAGGGGTGGAGG 0: 1
1: 0
2: 4
3: 78
4: 809
1148722279_1148722299 25 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652
1148722279_1148722293 16 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722293 17:49763044-49763066 AAAACAGCCTTGGTGGGTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 236
1148722279_1148722290 9 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722279_1148722295 18 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 228
1148722279_1148722296 21 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409
1148722279_1148722292 10 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722279_1148722286 -9 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722286 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722279 Original CRISPR CCAACGTGGCAGTGGGGTGA GGG (reversed) Intronic
900365685 1:2311129-2311151 CCTATGTGGCAGTGAGGGGAGGG - Intergenic
900374627 1:2347772-2347794 GCAGGGTGGCAGGGGGGTGACGG - Intronic
900380723 1:2382527-2382549 TCATGGTGGCAGTGGGGTGGGGG + Intronic
901434878 1:9241255-9241277 CCAAGGTGGGGGTGGGGGGAGGG - Intronic
902245534 1:15118266-15118288 CCAACATTGCAGGGGGGTGAGGG - Intergenic
904000004 1:27333553-27333575 CCCACGTGGTGGAGGGGTGAGGG + Intronic
904698846 1:32346331-32346353 TCAACGTGGGAGTGGGGAGGTGG + Intergenic
906141620 1:43537043-43537065 CCAAGGTGGCAGAGTGGTGTGGG + Intronic
909443701 1:75724783-75724805 CCAACATGGCAGCGGGGTTCGGG + Exonic
910572429 1:88720767-88720789 GAAAGGTGGGAGTGGGGTGAGGG - Intronic
911133346 1:94413877-94413899 TTAACTTGGCAATGGGGTGAAGG + Intergenic
915148245 1:153808334-153808356 CCACAGTGGCACTGGGGTGTGGG + Exonic
916117191 1:161496065-161496087 TCAAGGTGTCAGTAGGGTGAAGG - Intergenic
917056316 1:170985790-170985812 CCCACTGGGCAGAGGGGTGATGG - Intronic
919122772 1:193361739-193361761 AAAAGGTGGGAGTGGGGTGAGGG + Intergenic
920508951 1:206536595-206536617 CTATCTTGGCAGAGGGGTGATGG - Intronic
920767274 1:208845528-208845550 GAAGTGTGGCAGTGGGGTGAGGG + Intergenic
921131744 1:212225643-212225665 CCATCTAGGCAGTGGGGTGAAGG - Intergenic
921836474 1:219783693-219783715 GCAAGGTGGCAGAGTGGTGAAGG - Intronic
922825335 1:228513609-228513631 CCTCCGTGGCTGTGGGGTCATGG + Intergenic
1063456590 10:6187024-6187046 CCAATGTGGAAGTGCGGTGTGGG + Intronic
1064166239 10:12988733-12988755 CCTACGTGGTAGTGGGATGAGGG - Intronic
1065845783 10:29742069-29742091 CCAATGTGGCAGTGTTGAGAGGG + Intergenic
1069183139 10:65388658-65388680 CCAGCATTGCAGTTGGGTGAGGG + Intergenic
1069599388 10:69693709-69693731 CTAAGGTGGCAATGGGGTGATGG + Intergenic
1071006487 10:80889616-80889638 GCAAGGTGGCAGTGGGGAAAGGG + Intergenic
1071056626 10:81519142-81519164 AAAAGGTGGGAGTGGGGTGAGGG + Intergenic
1071588447 10:86847822-86847844 CCAAGATGGCAGTGGGATGGAGG - Intronic
1072265119 10:93719978-93720000 CCAAGGGCACAGTGGGGTGATGG + Intergenic
1073043407 10:100622252-100622274 CCAGGGTGGCATTGGGGTGTTGG + Intergenic
1073254973 10:102145079-102145101 CCAACGTGGCAGGTGGGTTCAGG + Exonic
1073397248 10:103228324-103228346 CCAACCAGGCAGTGTAGTGAAGG + Intergenic
1073768736 10:106711609-106711631 CGGAAATGGCAGTGGGGTGAAGG - Intronic
1075351492 10:121728847-121728869 CCAAGGTGGTTGTGGGGGGATGG + Intergenic
1075482905 10:122797731-122797753 CTAACATGCCAGTTGGGTGATGG + Intergenic
1076769693 10:132656235-132656257 GGAAGGTGGCAGTGGGGTCAGGG + Intronic
1076939570 10:133592903-133592925 CCAGCGTGGCGGTGGGGGGCAGG - Intergenic
1077109521 11:855933-855955 CCAGAGGGGCAGTGGGCTGAGGG + Intronic
1077391142 11:2301167-2301189 CCAGCGTGGCTGTGGGAAGAGGG - Intronic
1077551218 11:3201136-3201158 GGAAGGTGGCAGTGGGGGGAGGG - Intergenic
1078712568 11:13808969-13808991 CCAAGGTGGGGGTGGTGTGAGGG - Intergenic
1078730759 11:13971823-13971845 CCCGCTTGGCAGTAGGGTGATGG + Intronic
1079755094 11:24248761-24248783 CCAAGAAGGCAGTGGGATGAGGG + Intergenic
1081687943 11:45055691-45055713 CCCACCTGTCAGTGGGGAGAGGG - Intergenic
1084399253 11:68934207-68934229 TCAACGTGGAACTGGGGAGATGG - Intronic
1086952692 11:92907431-92907453 CAAATGTGGCAGTGGGAAGAAGG - Intergenic
1088665064 11:112086239-112086261 CCAGTGAGGCAGTGGGGTGACGG + Intronic
1089250139 11:117153463-117153485 CCAGGGTGGCAGGGGGGTGGAGG - Intronic
1092109250 12:5947241-5947263 CAAAGTTGGGAGTGGGGTGATGG + Intergenic
1100419365 12:94416816-94416838 CCAGCATTTCAGTGGGGTGAGGG - Intronic
1102191687 12:110993481-110993503 CAAACCTTGCACTGGGGTGAGGG - Intergenic
1104943584 12:132405936-132405958 CCCACGTGGCAGGGGTGTGCTGG + Intergenic
1108248308 13:48539689-48539711 CCATCATGCCAGTGGGGAGAAGG + Intergenic
1108751158 13:53449700-53449722 CAATCGTGGCAGAAGGGTGAAGG + Intergenic
1111940554 13:94602147-94602169 CCAACGTGGCAGGGAGGGGCCGG - Intronic
1111974508 13:94951583-94951605 CCAAAGTGTCAGTGGGGTTGAGG + Intergenic
1115848183 14:37561114-37561136 ACAACTTGGTGGTGGGGTGAGGG - Intergenic
1118115210 14:62768061-62768083 CCAGGGTGGGAGAGGGGTGAGGG + Intronic
1119905922 14:78301926-78301948 CCAACTTAGCAATGGGGTAAGGG - Intronic
1119998684 14:79279502-79279524 CCAACGTGGCACGGGGTGGAGGG - Intronic
1120897776 14:89549602-89549624 CCAAGGTGGGGGCGGGGTGAGGG + Intronic
1121855455 14:97265530-97265552 TCAAGGTGCCAGTGCGGTGAGGG + Intergenic
1122554252 14:102568570-102568592 CCAACGTGGGACTGGTGTGTGGG - Intergenic
1122838702 14:104443953-104443975 TCAAAGTGGCAGTGGGGGCAGGG + Intergenic
1129274937 15:74438863-74438885 CCAACGTGGCACTGGGCTTGTGG + Intergenic
1129320534 15:74772240-74772262 GCAACCTGGCTGCGGGGTGAGGG + Intergenic
1129708795 15:77809683-77809705 CCTGCCTGGCAGGGGGGTGAAGG + Intronic
1133222805 16:4326399-4326421 CCAGCGTGGCAGTGTTGTCAAGG - Intronic
1135208193 16:20499986-20500008 CCAAGGTGGCAGGGGGCTGGTGG - Intergenic
1135210706 16:20523714-20523736 CCAAGGTGGCAGGGGGCTGGTGG + Intergenic
1136169780 16:28482067-28482089 CCAAGGTGGGAGTGAAGTGAGGG + Intronic
1139751780 16:69113364-69113386 GCAGCCTGGCAGTGGGGTGGGGG + Intronic
1140315347 16:73891105-73891127 TCAAAGTGGCAGAGGTGTGAGGG - Intergenic
1145813339 17:27778148-27778170 ACAGGTTGGCAGTGGGGTGAGGG + Intronic
1147208111 17:38853522-38853544 CGAAAGTGGCAGTGGGGTGCTGG - Intronic
1147258730 17:39196808-39196830 TCAACGTGGGTGTGGGGGGAGGG + Intronic
1147380221 17:40050724-40050746 GGAAGGTGGGAGTGGGGTGAGGG + Intronic
1148489009 17:48011487-48011509 CCAACGGGGCATGGGGGAGATGG + Intergenic
1148722279 17:49763005-49763027 CCAACGTGGCAGTGGGGTGAGGG - Intronic
1150099229 17:62407589-62407611 CCAAAGGGGCAGTGCTGTGATGG + Intronic
1151675471 17:75595264-75595286 TGAACGTGGGTGTGGGGTGAGGG - Intergenic
1153982250 18:10320408-10320430 CCAGGGTGGCAGTGGGGCAAGGG + Intergenic
1154201618 18:12304575-12304597 CCAGCGAGGCAGTGGGGAGCAGG + Intergenic
1156562701 18:38146399-38146421 CCAGGGTGGCAGTGGAGTGGTGG + Intergenic
1159502125 18:69286788-69286810 CCAACATGGCAGTGCTGGGAGGG - Intergenic
1160412682 18:78685727-78685749 GCAAGGTGGCAGAGAGGTGATGG - Intergenic
1160579991 18:79878273-79878295 CCCACGTGGCAGTGTGCGGAGGG + Intronic
1160580004 18:79878336-79878358 CCCACGTGGCAGTGTGCGGAGGG + Intronic
1160580030 18:79878462-79878484 CCCACGTGGCAGTGTGCGGAGGG + Intronic
1161017421 19:1990193-1990215 CCAGCGTGTCTGTGGGGTGGAGG + Exonic
1161740419 19:6017878-6017900 CAAACGTGACAGTGGGGCGGGGG - Intronic
1162488065 19:10973989-10974011 CCAACGTGGGAGTCAGGTTATGG - Intronic
1164442618 19:28291086-28291108 CCAAAGCCACAGTGGGGTGATGG - Intergenic
1165024717 19:32951660-32951682 CCAAGGAGGGAGTGGGGTTAGGG + Intronic
1165787168 19:38468673-38468695 CCAAAGTGGTAGTGGGGGGCTGG - Intronic
1168467180 19:56612629-56612651 GCAAGGTGGCAGGGGGGTGAGGG + Intronic
925121402 2:1421476-1421498 CTTAAGTGGCAGAGGGGTGACGG - Intronic
925259318 2:2516308-2516330 CCAACCTGGGAGTGGGCAGAAGG - Intergenic
927520161 2:23693637-23693659 CCTAAGTGGCAGAGAGGTGAAGG + Intronic
927963513 2:27255277-27255299 TCGGCCTGGCAGTGGGGTGAGGG + Exonic
928419426 2:31126302-31126324 TCAACGTGGCTGTGAGGGGAGGG + Intronic
929813700 2:45213690-45213712 CCAGCGTGGTAGTAGGGGGAAGG - Intergenic
932782188 2:74566710-74566732 CCAAGCTGAGAGTGGGGTGATGG - Intronic
934609808 2:95726711-95726733 CTCACATGGCAGGGGGGTGAGGG + Intergenic
934860919 2:97763142-97763164 GCAATGTGGCAGTGAGGGGACGG - Intronic
937157256 2:119729993-119730015 CCCAGAGGGCAGTGGGGTGAAGG - Intergenic
937289492 2:120773652-120773674 CCCAGTTGGCTGTGGGGTGAGGG + Intronic
939305732 2:140408179-140408201 GCGATGTGGGAGTGGGGTGAGGG + Intronic
940471171 2:154102523-154102545 AAATCGTGGGAGTGGGGTGAGGG + Intronic
940789637 2:158018579-158018601 CCCAGGTGGCAGTGGGGGAAGGG + Intronic
946716890 2:222562223-222562245 CCACAGTGGCAGTGGGTTGGGGG - Intergenic
947700814 2:232232453-232232475 CCAAGGTGACAGTGGTGGGAAGG + Intronic
1170094215 20:12628521-12628543 CCAGCCTGGAAATGGGGTGATGG + Intergenic
1171407115 20:24918892-24918914 CCAACTTGCCAGTGGGGTGGGGG - Intergenic
1172285057 20:33734400-33734422 CCAGAGTGGCAGTGGGGGGTCGG + Intronic
1174796853 20:53529389-53529411 TCAGCATGGAAGTGGGGTGAGGG + Intergenic
1175664498 20:60846615-60846637 CCCATGTGGTATTGGGGTGATGG - Intergenic
1175720500 20:61283873-61283895 CCAGGGTGGCAGTGGGGACATGG - Intronic
1177171539 21:17661141-17661163 CCAGCTTGGCGGTGGGGTGGTGG + Intergenic
1177344665 21:19853993-19854015 GCAACGTAGCAGTAGGTTGATGG - Intergenic
1178768375 21:35477279-35477301 CCAGGGTGTCAGTGAGGTGATGG - Intronic
1180102117 21:45593256-45593278 GCGACGGGGCCGTGGGGTGATGG - Intergenic
1181321380 22:22009442-22009464 CAAACATGTCTGTGGGGTGAGGG + Intergenic
1183726812 22:39594518-39594540 GGAGAGTGGCAGTGGGGTGAGGG + Intronic
1183728017 22:39600219-39600241 CCCAGGTGGGGGTGGGGTGAGGG - Intronic
1184252717 22:43269809-43269831 CCAACGTTGAAGGGGGGTGAAGG + Intronic
1185131790 22:49043575-49043597 CTGACCAGGCAGTGGGGTGAGGG + Intergenic
1185147587 22:49147675-49147697 CCAACCTGGCAGTGGGGAGGAGG + Intergenic
950329396 3:12144456-12144478 CCTCTGTGGCAGTGTGGTGAAGG + Intronic
953410512 3:42688184-42688206 CCAAAGAGGCAGCGGGGCGAGGG - Exonic
957425741 3:80036796-80036818 CCAACTGGGCATTGAGGTGAAGG - Intergenic
958910756 3:99991589-99991611 GGAAGGTGGCAGGGGGGTGAGGG - Intronic
961135477 3:124505985-124506007 CCAAAGTGGCAGTTGGATGATGG + Intronic
963923066 3:150924560-150924582 CCAGGGTGGAAGTGAGGTGAGGG - Intronic
967214916 3:187201577-187201599 CTTATGTGGCAGTGGGGTCAGGG - Intergenic
967504650 3:190239737-190239759 GCAACATGGCAGAGGAGTGAAGG - Intergenic
969525986 4:7704359-7704381 CCCAGGTGGCTGGGGGGTGAAGG - Intronic
970724921 4:19032358-19032380 CCAAAGTGGCAATTTGGTGATGG + Intergenic
971253489 4:24992799-24992821 TGGATGTGGCAGTGGGGTGAGGG - Intergenic
981487245 4:145300554-145300576 CGAGCGTGGCAGTGGCGTAAGGG - Intergenic
985561149 5:586687-586709 GCAAGGTGGCAGTGGGGGAATGG + Intergenic
988641993 5:33050190-33050212 CCAAGGGGGAAGTGGGGTGATGG - Intergenic
989156182 5:38347031-38347053 CCAAGGTGGAAATGGGATGAGGG + Intronic
991316191 5:65309450-65309472 GCAATGTGGCAGTGGGGGGGTGG + Intronic
991930085 5:71745818-71745840 CCAAGGTGGCAGTGGGTAGGCGG - Intergenic
992217906 5:74543655-74543677 GCAACGGGGGTGTGGGGTGAGGG + Intergenic
992223177 5:74592726-74592748 ACAACATGGCAGAAGGGTGATGG + Intergenic
996719118 5:126612807-126612829 GCATGGTAGCAGTGGGGTGAAGG + Intronic
997426302 5:133805035-133805057 CCAAGGAGGCAGTGGGGTTGGGG - Intergenic
997978611 5:138454988-138455010 ACAACTTGGCAGTGGGGTGGAGG - Intergenic
999273078 5:150309387-150309409 CCAGCGTGGCAGGGGGTGGAGGG - Intronic
1001332657 5:170773177-170773199 GCATGGTGGCAGGGGGGTGAGGG + Intronic
1001687268 5:173603180-173603202 GCAAGGTGGCAGTGGGCTGAAGG - Intergenic
1001908243 5:175491581-175491603 CTGAGGTGGCAGTGGGGTGTGGG - Intronic
1007179712 6:39921043-39921065 CTTAGGTGGCAGTGGGGTGGGGG + Intronic
1009840984 6:69073824-69073846 CCAGGGTGGTAGAGGGGTGAGGG - Intronic
1010536500 6:77037611-77037633 CCATCATGGCAGAAGGGTGAAGG - Intergenic
1012375533 6:98557415-98557437 CCAACATGGCAGGGAGGAGAAGG + Intergenic
1013011271 6:106122663-106122685 CCAAGGTGGCAGTTTGATGAGGG - Intergenic
1018446867 6:163866339-163866361 TCACCGTGGCTGTGGGGTGTGGG + Intergenic
1021420903 7:20443661-20443683 CAATCTGGGCAGTGGGGTGAGGG - Intergenic
1022099640 7:27161517-27161539 CCAACCTGGCGGCGGGGTGGGGG + Intergenic
1023223904 7:37949256-37949278 CCAAAGTGGCAGAGAGGTGCAGG - Intronic
1032194401 7:129780910-129780932 CCACTGTCGCAGTGGGGGGAGGG - Intergenic
1032348002 7:131134706-131134728 CCATAGCAGCAGTGGGGTGAAGG - Intronic
1034497130 7:151429828-151429850 CCAAGGAGGCTGTGGGGTGGAGG + Intronic
1035627953 8:1088044-1088066 CCATTTTGGCAGTGGTGTGAAGG - Intergenic
1036479867 8:9130154-9130176 CCATGGTGGGAGTGGGGTGGGGG + Intergenic
1038020109 8:23545499-23545521 CCAACAGGCCAGTGCGGTGACGG + Intronic
1040711854 8:50198267-50198289 TGAAGGTGGCAGTGGGGAGAAGG + Intronic
1045398686 8:101788171-101788193 CGAATGTGGAAATGGGGTGATGG + Intronic
1048335253 8:133497792-133497814 GGAATGTGGCAGTGGGGTGGGGG - Intronic
1049390874 8:142370071-142370093 CTCACGTGGCAGAAGGGTGAAGG - Intronic
1050746962 9:8887337-8887359 CCATCGTGGCAGTGAGATGCTGG + Intronic
1051213465 9:14770846-14770868 CCAACGTTGCATGGGGGTGAGGG - Intronic
1051541065 9:18217909-18217931 CCAACTTGGGAGTGGGGGTAAGG + Intergenic
1051704370 9:19860821-19860843 CCGAGGTGGCAGTGGCCTGAAGG + Intergenic
1053463001 9:38285027-38285049 CCAGGGTGCCAGTGGGGTGGAGG - Intergenic
1054907322 9:70422196-70422218 CCCATGTGACAGTGGGGTGGAGG - Intergenic
1057194423 9:93108870-93108892 GCCACCTGGCACTGGGGTGATGG - Intronic
1061237013 9:129349179-129349201 CCCAGGTGGCAGTGTGGTGGTGG + Intergenic
1061731431 9:132617400-132617422 CCAACATGTTAGTGGGGTGCAGG - Intronic
1062399833 9:136367487-136367509 CCCTCCTGGCAGTGGGGTGAGGG - Intronic
1062413742 9:136437754-136437776 GCACCATGGCAGTGGGGTGGGGG + Intronic
1188808486 X:34621631-34621653 CCAAAGTGGCACTAGAGTGAAGG + Intergenic
1190264446 X:48819169-48819191 CCATTGTGGCTGTGTGGTGATGG + Intronic
1190328206 X:49219542-49219564 CCAAGGTGGGAGTGGGGGCATGG - Intronic
1190692548 X:52923564-52923586 CCAACGTGTCATTGGAGTCAGGG + Intergenic
1191631393 X:63325701-63325723 ACAAAGTGGCAATGGTGTGATGG + Intergenic
1196634968 X:117991899-117991921 ACAATGTGGGAGGGGGGTGAGGG - Intronic
1196791478 X:119468649-119468671 CCAACCAGGAAGTGGGGGGAAGG + Intronic
1197538386 X:127722793-127722815 CTTACATGGCAGTGGGGGGAGGG - Intergenic
1199642823 X:149880963-149880985 CTGAGGTGGCAGTGGGGGGAAGG - Intergenic
1199872702 X:151913095-151913117 CTTAAGTGGCAGTGGGGTGGTGG - Intronic
1199897687 X:152138930-152138952 CCAAGGTGGCAGTGAGGGGAGGG + Intergenic
1199951875 X:152714256-152714278 CCGAAGTGGCATTGGGGGGAGGG - Intergenic
1199957808 X:152754192-152754214 CCGAAGTGGCATTGGGGGGAGGG + Intergenic
1200838876 Y:7759933-7759955 CCACTGTGACAGTGGAGTGAGGG - Intergenic