ID: 1148722281

View in Genome Browser
Species Human (GRCh38)
Location 17:49763006-49763028
Sequence GCCAACGTGGCAGTGGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 258}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722281_1148722290 8 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722281_1148722295 17 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 228
1148722281_1148722298 23 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722298 17:49763052-49763074 CTTGGTGGGTAGAGGGGTGGAGG 0: 1
1: 0
2: 4
3: 78
4: 809
1148722281_1148722299 24 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652
1148722281_1148722287 5 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722281_1148722292 9 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722281_1148722286 -10 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722286 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 124
1148722281_1148722294 16 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722294 17:49763045-49763067 AAACAGCCTTGGTGGGTAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 391
1148722281_1148722293 15 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722293 17:49763044-49763066 AAAACAGCCTTGGTGGGTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 236
1148722281_1148722296 20 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722281 Original CRISPR GCCAACGTGGCAGTGGGGTG AGG (reversed) Intronic
900340198 1:2184893-2184915 GCAAAGGTGGCAGGGGGGAGGGG - Intronic
900380722 1:2382526-2382548 GTCATGGTGGCAGTGGGGTGGGG + Intronic
902245536 1:15118267-15118289 GCCAACATTGCAGGGGGGTGAGG - Intergenic
902632081 1:17710925-17710947 GGCAATGTGGCAGGGTGGTGGGG + Intergenic
902747402 1:18482830-18482852 GCGAACGTGTCACTGGGGAGCGG - Exonic
902952099 1:19893136-19893158 GCCAACGTGGAATTGAGGAGCGG - Intronic
904581724 1:31548668-31548690 GCCAACGTGGGCGGGGGGCGTGG + Intergenic
904870933 1:33617666-33617688 GTCAACGTGGCGGTAGGCTGGGG + Intronic
905634538 1:39540911-39540933 GGCAACAGGGCAGTGTGGTGTGG + Intergenic
906141618 1:43537042-43537064 GCCAAGGTGGCAGAGTGGTGTGG + Intronic
906472863 1:46145676-46145698 CCCAACGTGGCAGTGTTGGGAGG - Intronic
907316688 1:53576995-53577017 GCCAAGGGGACAGTGTGGTGGGG - Intronic
908510503 1:64846918-64846940 GCCAACCTGGCAGGGATGTGAGG + Intronic
909443699 1:75724782-75724804 GCCAACATGGCAGCGGGGTTCGG + Exonic
910256514 1:85253517-85253539 GCCATCGTGGGAGTGGGGATGGG - Intronic
910572430 1:88720768-88720790 GGAAAGGTGGGAGTGGGGTGAGG - Intronic
911071164 1:93832869-93832891 GAAAAGGTGGCAGTGAGGTGTGG - Intronic
911125767 1:94339754-94339776 GGCAAGGAAGCAGTGGGGTGGGG + Intergenic
912382115 1:109253400-109253422 GCCCAGGTGGCGCTGGGGTGGGG + Intronic
914349331 1:146826820-146826842 GCCACCCTGGCAAGGGGGTGGGG - Intergenic
915148243 1:153808333-153808355 CCCACAGTGGCACTGGGGTGTGG + Exonic
919122771 1:193361738-193361760 GAAAAGGTGGGAGTGGGGTGAGG + Intergenic
920767273 1:208845527-208845549 GGAAGTGTGGCAGTGGGGTGAGG + Intergenic
920881262 1:209882462-209882484 GGCAAGGGGGCAGTGGGGCGAGG - Intergenic
921014607 1:211177013-211177035 GACAACTTGGAAGTGGGGAGGGG - Intergenic
921653872 1:217711293-217711315 GCCTACTTGGCAGTGCGGGGTGG - Intronic
924624757 1:245688863-245688885 GACACCCTGGCAGTGGGGTTTGG - Intronic
924624785 1:245688944-245688966 GACACCCTGGCAGTGGGGTTTGG - Intronic
1063456588 10:6187023-6187045 ACCAATGTGGAAGTGCGGTGTGG + Intronic
1064166241 10:12988734-12988756 ACCTACGTGGTAGTGGGATGAGG - Intronic
1064225919 10:13485092-13485114 CCTAACGGGGCAGAGGGGTGGGG - Intronic
1065481092 10:26194489-26194511 GTCACTGTGGCAGTGGGGAGTGG - Intronic
1065529929 10:26658713-26658735 CCCAAGGTGGCAGTGGTGGGAGG - Intergenic
1067815372 10:49471583-49471605 TCCAGAGTGGCAGTGGTGTGGGG - Intronic
1069183137 10:65388657-65388679 GCCAGCATTGCAGTTGGGTGAGG + Intergenic
1069787246 10:70996759-70996781 GCCAAGCTGGCTGTGGGCTGTGG + Intergenic
1069827102 10:71261021-71261043 GCCAGCGTGGGAATGGGGAGAGG + Intronic
1069930936 10:71881100-71881122 GTCAGCCTGGCAGAGGGGTGGGG + Intergenic
1070756007 10:78993704-78993726 CCCACCGAGGCAGTGGGGGGTGG + Intergenic
1070770410 10:79079184-79079206 GCCAACTGGGCAGAGGGGTGGGG + Intronic
1071056625 10:81519141-81519163 GAAAAGGTGGGAGTGGGGTGAGG + Intergenic
1075374409 10:121966591-121966613 GCCAATGTAGTAGTGTGGTGTGG - Intronic
1075653455 10:124145441-124145463 TTAAACGTGGGAGTGGGGTGGGG + Intergenic
1076450998 10:130556902-130556924 CCCAACGTGGCAGTGTTGAGAGG + Intergenic
1076769692 10:132656234-132656256 GGGAAGGTGGCAGTGGGGTCAGG + Intronic
1077027278 11:446458-446480 ACCAGGGTGGCATTGGGGTGGGG + Intergenic
1077109519 11:855932-855954 GCCAGAGGGGCAGTGGGCTGAGG + Intronic
1077234001 11:1471124-1471146 GCCACCTGGGCTGTGGGGTGAGG - Intronic
1078341985 11:10503925-10503947 GCTACAGCGGCAGTGGGGTGGGG + Intronic
1078712570 11:13808970-13808992 GCCAAGGTGGGGGTGGTGTGAGG - Intergenic
1080654110 11:34245257-34245279 GCCAGGGTGGCAGTGTGGTGGGG - Intronic
1081687945 11:45055692-45055714 GCCCACCTGTCAGTGGGGAGAGG - Intergenic
1082829417 11:57604433-57604455 GTCATGGTGGGAGTGGGGTGTGG + Intronic
1083067831 11:59944145-59944167 GCCACCCTGGGAGAGGGGTGTGG + Intergenic
1083902661 11:65651125-65651147 GCCAGGGTAGCTGTGGGGTGTGG - Intergenic
1084491296 11:69480043-69480065 GCAAACGGGACAGTGGGGCGAGG + Intergenic
1086550311 11:88045999-88046021 GAAAAGGTGGCAGTGAGGTGTGG - Intergenic
1090120821 11:124026048-124026070 GCCAAGGTTGCAGTGAGTTGAGG - Intergenic
1090910191 11:131111661-131111683 GCCAAGATGGCAGGGGGCTGGGG + Intergenic
1091339597 11:134800210-134800232 GTCAACGTGGCCGTGTGGCGCGG + Intergenic
1094597289 12:31876732-31876754 GCCAGTGTGGCAGTGGTGAGTGG + Intergenic
1096669821 12:53191953-53191975 GGCATCGTGGCAGTGGGGCTGGG - Exonic
1098632931 12:72746511-72746533 GCCTACGTGACAGTGGAATGTGG + Intergenic
1100419367 12:94416817-94416839 GCCAGCATTTCAGTGGGGTGAGG - Intronic
1102036006 12:109770887-109770909 GCCATGGTGGCAGTGGGGCTGGG + Intergenic
1102448729 12:113024498-113024520 GCCAATGTGGCTGTTGGGTACGG - Intergenic
1102601320 12:114032723-114032745 GGCAACGTGGTGGTGGTGTGGGG + Intergenic
1102728764 12:115089517-115089539 GCCAAAGTGTCGGTGGCGTGTGG + Intergenic
1103654671 12:122460879-122460901 GCCAAGGTTGCAGTGAGCTGAGG - Intergenic
1104849016 12:131862291-131862313 GCCAGCGTGACAGTGGGCAGGGG + Intergenic
1107414367 13:40187569-40187591 GCCAGCAAGGAAGTGGGGTGGGG - Intergenic
1108087449 13:46808898-46808920 GTCAAGGTTGCAGTGAGGTGTGG - Intergenic
1110201085 13:72851429-72851451 GCCGAGGTGGCAGGGGGCTGGGG - Intronic
1114549319 14:23524021-23524043 GCAAGCGTGGCAGTGGGGTAGGG + Exonic
1115215872 14:31013521-31013543 ACTAACTTGGCAGTGGGGGGTGG + Intronic
1118115208 14:62768060-62768082 GCCAGGGTGGGAGAGGGGTGAGG + Intronic
1118822320 14:69353500-69353522 GCCCAAGAGCCAGTGGGGTGAGG - Exonic
1119759667 14:77141568-77141590 GCCGCCGTCGCAGAGGGGTGAGG + Intronic
1121588211 14:95078629-95078651 GGCAGTGTGGCAGCGGGGTGGGG - Intergenic
1121613614 14:95298144-95298166 GCCATGGTGGCAGCCGGGTGGGG - Intronic
1122459721 14:101884860-101884882 ACGAAACTGGCAGTGGGGTGGGG - Intronic
1122554254 14:102568571-102568593 CCCAACGTGGGACTGGTGTGTGG - Intergenic
1122838701 14:104443952-104443974 GTCAAAGTGGCAGTGGGGGCAGG + Intergenic
1123934355 15:25186969-25186991 GCCAAGTTGGCAGTGGTGCGTGG + Intergenic
1127442287 15:59021926-59021948 GGCAAGGTTGCAGTGAGGTGAGG - Intronic
1129111573 15:73340146-73340168 GCCAGGGTGGCAGTGGGGACAGG + Intronic
1129320533 15:74772239-74772261 GGCAACCTGGCTGCGGGGTGAGG + Intergenic
1130563160 15:84974490-84974512 GCCAACCTGGCAGGGGTTTGGGG + Intergenic
1132135780 15:99337218-99337240 GCCAAGGTGGCAGTGTTGTTGGG + Intronic
1132926997 16:2435880-2435902 GCCAACATGCAGGTGGGGTGAGG - Intronic
1136169778 16:28482066-28482088 GCCAAGGTGGGAGTGAAGTGAGG + Intronic
1136228125 16:28872435-28872457 GCATAGTTGGCAGTGGGGTGGGG + Intronic
1136570406 16:31093416-31093438 CCCCACCTGGCAGAGGGGTGGGG + Exonic
1137249232 16:46730364-46730386 GCCCACGTGGCATCGGGGAGGGG - Intronic
1139751779 16:69113363-69113385 AGCAGCCTGGCAGTGGGGTGGGG + Intronic
1139984705 16:70888734-70888756 GCCACCCTGGCAAGGGGGTGGGG + Intronic
1140315348 16:73891106-73891128 GTCAAAGTGGCAGAGGTGTGAGG - Intergenic
1140566372 16:76047593-76047615 GCCTACTTGACAGTGGAGTGTGG - Intergenic
1141938960 16:87261586-87261608 GCCCACTGGGCAGTTGGGTGCGG + Intronic
1142727814 17:1829581-1829603 GGCACCGTGGCGGTGGGGGGTGG - Intronic
1143255540 17:5554952-5554974 GCCAAGGTTGCAGTGAGGTATGG + Intronic
1143869970 17:9951095-9951117 GCCTGCTTGGCAGTGGGTTGTGG - Intronic
1144119807 17:12140898-12140920 GCCACCTTGGCAGTGAGGTCTGG - Intronic
1145813338 17:27778147-27778169 GACAGGTTGGCAGTGGGGTGAGG + Intronic
1147258729 17:39196807-39196829 GTCAACGTGGGTGTGGGGGGAGG + Intronic
1147380220 17:40050723-40050745 GGGAAGGTGGGAGTGGGGTGAGG + Intronic
1147561844 17:41514157-41514179 GCCACCGTGGCAGAGCGGGGAGG - Intronic
1148321400 17:46757083-46757105 GCCACAGTGGCACTTGGGTGTGG + Exonic
1148323159 17:46769619-46769641 GACGAAGTGGCTGTGGGGTGGGG + Intronic
1148323834 17:46772066-46772088 GCCCACGCGGCGGTGGTGTGGGG + Intronic
1148460432 17:47836543-47836565 GCTAAGGTGGCAGTGGCGTCCGG + Intronic
1148722281 17:49763006-49763028 GCCAACGTGGCAGTGGGGTGAGG - Intronic
1148861438 17:50606312-50606334 GCACACGTGGCAGTGGGGGCAGG + Intronic
1150727927 17:67666616-67666638 GCCACCGTGGCAGCAGAGTGGGG + Intronic
1151317831 17:73334923-73334945 GCCAGAGTGGCACTGTGGTGAGG + Exonic
1151678970 17:75614109-75614131 GCCAAGGGGGCAGGGGGCTGAGG - Intergenic
1151751531 17:76041371-76041393 GCCCAAGTGGCAGCGGGCTGGGG + Intronic
1152108461 17:78343798-78343820 GCCCATGTGGCTGGGGGGTGGGG - Intergenic
1153662721 18:7339818-7339840 GCCAACTAAGCAGTGGGGTCTGG + Intergenic
1153834247 18:8949939-8949961 GCCAGCGTGGCAGAGGAGGGGGG + Intergenic
1153982248 18:10320407-10320429 GCCAGGGTGGCAGTGGGGCAAGG + Intergenic
1154064708 18:11096167-11096189 GCCAGCCTGGCTGTGGGGTGTGG + Intronic
1156654881 18:39273161-39273183 TCCATCGTGGCAGTGGTGGGAGG + Intergenic
1157239001 18:45992083-45992105 GTGAATGGGGCAGTGGGGTGGGG - Intronic
1157303372 18:46497227-46497249 TCCAAAGTGGTGGTGGGGTGGGG + Intronic
1158290543 18:55936329-55936351 CTCAACTAGGCAGTGGGGTGGGG + Intergenic
1160201784 18:76802052-76802074 GCCCACGTGGGAGTGGGATTGGG + Intronic
1160579989 18:79878272-79878294 GCCCACGTGGCAGTGTGCGGAGG + Intronic
1160580002 18:79878335-79878357 GCCCACGTGGCAGTGTGCGGAGG + Intronic
1160580028 18:79878461-79878483 GCCCACGTGGCAGTGTGCGGAGG + Intronic
1160877742 19:1305046-1305068 GCCACCGGGGCTGTGGGGGGCGG - Intergenic
1161244747 19:3243655-3243677 GCCACCGTGTCTGTGGTGTGTGG - Intronic
1161532218 19:4796728-4796750 CCTCACGTGGCAGTGGGGAGAGG + Exonic
1161740420 19:6017879-6017901 GCAAACGTGACAGTGGGGCGGGG - Intronic
1161932336 19:7349285-7349307 GACAGAGTGGCAGTGGGGTCTGG + Intronic
1162561640 19:11421024-11421046 GCCAAGGTGGGGGTGGAGTGGGG - Intronic
1163161134 19:15464600-15464622 CCCAGCCTGGCTGTGGGGTGGGG - Intergenic
1163773775 19:19206198-19206220 GCCCAGGCGCCAGTGGGGTGAGG - Intergenic
1164815280 19:31194481-31194503 ATCTAAGTGGCAGTGGGGTGGGG + Intergenic
1165351371 19:35277701-35277723 GCCACCCTGGCAGGGGGCTGGGG + Intronic
1168467179 19:56612628-56612650 GGCAAGGTGGCAGGGGGGTGAGG + Intronic
1168713449 19:58514369-58514391 GCCCAGGTGGGGGTGGGGTGGGG - Intronic
926123223 2:10256018-10256040 GCCAAATTGGGGGTGGGGTGGGG + Intergenic
926844192 2:17116216-17116238 GGCGGGGTGGCAGTGGGGTGGGG - Intergenic
927084351 2:19659693-19659715 ACCAAAGTGTCAGTGGGGTGGGG + Intergenic
928083272 2:28328490-28328512 GCCAATGTGGTGGTAGGGTGGGG - Intronic
929065700 2:37972708-37972730 ACCAAGGTGGTAGTGGGGAGAGG + Intronic
929599835 2:43198164-43198186 GCCAGGCTGGCAGTGGGGTAGGG + Intergenic
929933333 2:46275539-46275561 GGCACCATGGCAGTGTGGTGGGG - Intergenic
930159998 2:48145059-48145081 GCCACAGTAGTAGTGGGGTGGGG + Intergenic
935603661 2:104948025-104948047 GGCAGAGTGGGAGTGGGGTGGGG - Intergenic
937699459 2:124847412-124847434 GACTACATGGGAGTGGGGTGAGG - Intronic
937955304 2:127418765-127418787 CCAAAGGTGGAAGTGGGGTGGGG - Intronic
939305731 2:140408178-140408200 GGCGATGTGGGAGTGGGGTGAGG + Intronic
940986378 2:160056054-160056076 GCTAAAGTGGCTTTGGGGTGTGG - Intronic
940986778 2:160058831-160058853 GCCAATGGGGTGGTGGGGTGGGG + Intronic
944414312 2:199467759-199467781 GCCAACGTGGTGGTGGTGAGGGG - Intronic
945971679 2:216237253-216237275 GCCCAGGGTGCAGTGGGGTGTGG + Intergenic
946716892 2:222562224-222562246 CCCACAGTGGCAGTGGGTTGGGG - Intergenic
946749781 2:222882464-222882486 GTCGAGGAGGCAGTGGGGTGGGG + Intronic
947263495 2:228251556-228251578 GCAGCAGTGGCAGTGGGGTGGGG + Intergenic
948915798 2:241034551-241034573 GCCAGCCTGGGGGTGGGGTGGGG - Exonic
1168953360 20:1817598-1817620 TCCAAGGTGCCTGTGGGGTGTGG + Intergenic
1170632935 20:18080853-18080875 GCCAAGGTTGCAGTGGGCCGAGG + Intergenic
1171407117 20:24918893-24918915 GCCAACTTGCCAGTGGGGTGGGG - Intergenic
1173091363 20:39975148-39975170 GCCAAGGTCCCAGTGGGGAGGGG - Intergenic
1173362981 20:42361037-42361059 GCCAAGGTGGCAGGGTGGGGCGG - Intronic
1174089765 20:48037730-48037752 GCAAACCTGTCAGTGGGATGGGG + Intergenic
1174462341 20:50691599-50691621 GCCAAAATGGGAGTGGGGGGTGG - Intergenic
1175125640 20:56749414-56749436 GCCAAAGAGGCCCTGGGGTGTGG + Intergenic
1177759648 21:25388879-25388901 GCAAACCTGACAGTGGGGTGAGG - Intergenic
1178579629 21:33827330-33827352 GCCAAGGTGGCAGTGAGCCGAGG + Intronic
1179954402 21:44730143-44730165 GCCAAGGTGGCAGCAGGGTCGGG + Intergenic
1181009335 22:20031405-20031427 GGCAACGTGGCATGGTGGTGAGG - Intronic
1181390829 22:22579690-22579712 GCCCAGGTGAGAGTGGGGTGAGG + Intergenic
1181407890 22:22697802-22697824 GCCCACGTGAGGGTGGGGTGAGG + Intergenic
1181457034 22:23065659-23065681 GCCTACCTGGCAGGGGGTTGTGG + Intronic
1183726811 22:39594517-39594539 GGGAGAGTGGCAGTGGGGTGAGG + Intronic
1184682621 22:46080216-46080238 GCAGACGTGGCAGTGGCGGGTGG - Intronic
1185408559 22:50671394-50671416 GGCAGCGGGGCAGTGGGCTGGGG + Intergenic
953410514 3:42688185-42688207 GCCAAAGAGGCAGCGGGGCGAGG - Exonic
954317358 3:49808357-49808379 GCCCAAGTGGCAGTGAGGAGTGG - Intronic
954895627 3:53972687-53972709 GCCAACGTGGCAGATGGGAAAGG - Intergenic
955392509 3:58531687-58531709 GCTTACCTGGCAGTGGGGTGTGG + Exonic
958910757 3:99991590-99991612 GGGAAGGTGGCAGGGGGGTGAGG - Intronic
961710494 3:128824438-128824460 GCCAGCCTGGCAGTGGCGAGTGG + Intergenic
961881140 3:130062081-130062103 GAAAACGTGGCAATGAGGTGTGG - Intergenic
962021128 3:131502886-131502908 GTCCACGTGGCGGTGGCGTGGGG - Exonic
966046844 3:175561949-175561971 GCCAAGGTGGCAGTGGTGGGAGG + Intronic
966890850 3:184406508-184406530 GCCACTGTGTGAGTGGGGTGCGG + Intronic
967831212 3:193921744-193921766 GTCTAAGTGGCAGTGTGGTGTGG - Intergenic
968034962 3:195540550-195540572 TCCAATGTGGCAGTGTGGAGAGG + Intronic
968518874 4:1026784-1026806 GCCACCACGACAGTGGGGTGGGG - Exonic
968657093 4:1783389-1783411 GTCAACGTTGCAGCGGGGGGAGG + Intergenic
970532836 4:17000476-17000498 GAAAAGGTGGCAGTGAGGTGTGG - Intergenic
971253490 4:24992800-24992822 GTGGATGTGGCAGTGGGGTGAGG - Intergenic
971493407 4:27238096-27238118 TCCAACATGGCAGTGTGGAGAGG - Intergenic
972503533 4:39698696-39698718 GGAAATGTGGCTGTGGGGTGGGG + Intronic
975521805 4:75309855-75309877 GCAAAAGTGGAAGTGGGGTGGGG - Intergenic
978142087 4:105329604-105329626 GCCAACTTGGGAGTGGGGGTAGG - Intergenic
979524056 4:121698577-121698599 GGCAACCCGCCAGTGGGGTGGGG - Intergenic
979557601 4:122067295-122067317 GCCAGCGTGGCAGTGTGGCAGGG - Intergenic
983479929 4:168260512-168260534 GACAACTTGGCAGTGGGTGGCGG + Intronic
984022908 4:174507534-174507556 GCCAAGGTTGGGGTGGGGTGTGG + Intronic
985468031 5:16083-16105 CCCAATGTGGCAGTGTGGGGCGG + Intergenic
987755916 5:22097652-22097674 GAAAAGGTGGCAGTGAGGTGTGG - Intronic
990251796 5:53923386-53923408 GACAAGGAGGCAGTGGGGTGGGG - Intronic
995412912 5:111878738-111878760 GCTCAAGTGGCAGGGGGGTGGGG - Intronic
997362486 5:133303921-133303943 GCCAAGGAGGCAGTGGGCTTGGG + Intronic
997426304 5:133805036-133805058 ACCAAGGAGGCAGTGGGGTTGGG - Intergenic
997894877 5:137707363-137707385 GCGAAGGTGGCAGTGAGTTGAGG + Intronic
998216056 5:140239443-140239465 GCCAAAGTGGCAGTGGGCACTGG + Intronic
998761263 5:145434670-145434692 GACCAGGTGGCAGTGGGATGGGG - Intergenic
1001332656 5:170773176-170773198 GGCATGGTGGCAGGGGGGTGAGG + Intronic
1001908244 5:175491582-175491604 GCTGAGGTGGCAGTGGGGTGTGG - Intronic
1007179711 6:39921042-39921064 CCTTAGGTGGCAGTGGGGTGGGG + Intronic
1008422547 6:51318831-51318853 GCGAGCTTGGCAGTGGGCTGAGG - Intergenic
1008773389 6:55007148-55007170 GCCAAGGTTGCAGTGAGCTGAGG - Intergenic
1009840986 6:69073825-69073847 GCCAGGGTGGTAGAGGGGTGAGG - Intronic
1013468314 6:110437010-110437032 GCCAAAGTGGGAGTGGTGAGTGG - Intronic
1018446866 6:163866338-163866360 CTCACCGTGGCTGTGGGGTGTGG + Intergenic
1018871648 6:167788376-167788398 GCCCACGGGGCCGGGGGGTGGGG + Intronic
1018900543 6:168049745-168049767 GCCAGGGTGGGGGTGGGGTGGGG + Intergenic
1019234595 6:170599697-170599719 CCCAATGTGGCAGTGTGGGGAGG - Intergenic
1019313580 7:374533-374555 GCCGCGGTGGGAGTGGGGTGAGG - Intergenic
1019431361 7:1001306-1001328 ACCCACATGGCAGTGGGGTCAGG - Intronic
1019529479 7:1496311-1496333 GCCCACGTGGGTGTGGAGTGGGG - Intronic
1019529498 7:1496372-1496394 GCCCACGTGGGTGTGGAGTGGGG - Intronic
1019529517 7:1496433-1496455 GCCCACGTGGGTGTGGAGTGGGG - Intronic
1021376299 7:19911419-19911441 GGCAGGGTGGCAGTGGGGAGTGG + Intergenic
1021620780 7:22549720-22549742 GCCGTGGTGGCCGTGGGGTGAGG + Intronic
1022099638 7:27161516-27161538 CCCAACCTGGCGGCGGGGTGGGG + Intergenic
1023327405 7:39075048-39075070 GGCACCGTGGGACTGGGGTGTGG + Intronic
1027195686 7:76028586-76028608 GGCTACCTTGCAGTGGGGTGGGG - Intronic
1028574503 7:92331757-92331779 GGCCACGTGACAGTGAGGTGTGG - Intronic
1028678229 7:93493268-93493290 GCCAATGTGGTGGTGTGGTGAGG - Intronic
1029712492 7:102307301-102307323 GCCACCCTGGCAGCGGTGTGGGG - Intronic
1032194403 7:129780911-129780933 GCCACTGTCGCAGTGGGGGGAGG - Intergenic
1033462509 7:141560605-141560627 GGAAAGGTGGGAGTGGGGTGAGG - Intronic
1034185914 7:149176893-149176915 GAAAACGTGGGAGTGGGGTGGGG + Intronic
1034447760 7:151122197-151122219 GCCAAAGGGGCAGAGGGCTGTGG + Intronic
1035591516 8:818300-818322 GGCTGCGTGGGAGTGGGGTGAGG - Intergenic
1036479865 8:9130153-9130175 ACCATGGTGGGAGTGGGGTGGGG + Intergenic
1037569172 8:20144126-20144148 ACACAGGTGGCAGTGGGGTGGGG - Intergenic
1037748140 8:21662677-21662699 GCCAAGGTGGGACTGGGGAGGGG - Intergenic
1037875552 8:22545540-22545562 GCCAAGGTGGCAGGGGCGTGAGG - Intronic
1039050022 8:33484664-33484686 CCCAACGTGGGCGTGGGGAGTGG + Intronic
1039849238 8:41348047-41348069 GCCACGGTGGGAGTGTGGTGGGG + Intergenic
1041727329 8:61030291-61030313 GAGAAGGTGGCAGCGGGGTGGGG + Intergenic
1042660586 8:71150144-71150166 GGCAACGTGGTGGTGGGGGGGGG - Intergenic
1044751933 8:95424391-95424413 GCCAAGGGGGTGGTGGGGTGGGG + Intergenic
1047856472 8:128917227-128917249 GAAAAGGTGGCAGTGAGGTGTGG - Intergenic
1048335254 8:133497793-133497815 AGGAATGTGGCAGTGGGGTGGGG - Intronic
1050679930 9:8099071-8099093 GGGATGGTGGCAGTGGGGTGGGG - Intergenic
1051213467 9:14770847-14770869 CCCAACGTTGCATGGGGGTGAGG - Intronic
1056836581 9:89960613-89960635 TCCAATTTGGAAGTGGGGTGAGG + Intergenic
1057772662 9:97982762-97982784 GCCAAGGAGGCAGCGGGGTTCGG + Intergenic
1057880093 9:98786731-98786753 ACCAACTTTGCTGTGGGGTGGGG + Intronic
1058995160 9:110292315-110292337 GCCCACGTGGAAGTGGGGCTGGG - Intergenic
1061230920 9:129315419-129315441 GCCAGGGTGGGGGTGGGGTGGGG + Intergenic
1061479152 9:130888008-130888030 AGCGACGTGGAAGTGGGGTGAGG + Intergenic
1062304534 9:135896804-135896826 CCCAATGTGGCAGTGGTGAGAGG + Intronic
1062399835 9:136367488-136367510 CCCCTCCTGGCAGTGGGGTGAGG - Intronic
1062413741 9:136437753-136437775 GGCACCATGGCAGTGGGGTGGGG + Intronic
1062442542 9:136577368-136577390 GGCCACTTGGCAGTGGCGTGTGG + Intergenic
1062572444 9:137191887-137191909 TCCAAGGGGGAAGTGGGGTGGGG - Exonic
1062713554 9:137990151-137990173 GGCTGCGTGGGAGTGGGGTGAGG + Intronic
1185833814 X:3326916-3326938 GTCAAAGAGGCAATGGGGTGTGG - Intronic
1186865779 X:13719379-13719401 GCCAAGGTGTCACTGGGGAGGGG + Intronic
1187669866 X:21657364-21657386 GCCAACGTGGCAGCGCGCTTTGG - Exonic
1190382046 X:49848463-49848485 CCCAGCGTGGCAGTGTGGGGTGG - Intergenic
1191846298 X:65550342-65550364 CCCAGCCTGGCAGTGGGGGGTGG + Intergenic
1193000800 X:76559965-76559987 GGCAAGGTGGCAGTGAGGTTGGG + Intergenic
1193472675 X:81926011-81926033 GCCAGCGAAGCAGTGGGGGGAGG - Intergenic
1196082761 X:111650020-111650042 GCCAAACTGGCAGTAGAGTGGGG + Intergenic
1197374384 X:125664067-125664089 GCCCATGTGTCAGTGGGGTGAGG - Intergenic
1199384693 X:147209412-147209434 TCCAACCTGACATTGGGGTGGGG - Intergenic
1199894531 X:152117775-152117797 GCTTAAGTGGCAGTGGGGAGGGG + Intergenic
1199897685 X:152138929-152138951 TCCAAGGTGGCAGTGAGGGGAGG + Intergenic
1201861134 Y:18598409-18598431 TCAAACGTGGCAGTGGGATCTGG - Intergenic
1201872189 Y:18721971-18721993 TCAAACGTGGCAGTGGGATCTGG + Intergenic