ID: 1148722282

View in Genome Browser
Species Human (GRCh38)
Location 17:49763011-49763033
Sequence TTGCAGCCAACGTGGCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722282_1148722295 12 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 228
1148722282_1148722298 18 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722298 17:49763052-49763074 CTTGGTGGGTAGAGGGGTGGAGG 0: 1
1: 0
2: 4
3: 78
4: 809
1148722282_1148722294 11 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722294 17:49763045-49763067 AAACAGCCTTGGTGGGTAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 391
1148722282_1148722290 3 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722282_1148722293 10 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722293 17:49763044-49763066 AAAACAGCCTTGGTGGGTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 236
1148722282_1148722292 4 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722282_1148722287 0 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722282_1148722296 15 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409
1148722282_1148722299 19 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722282 Original CRISPR TTGCAGCCAACGTGGCAGTG GGG (reversed) Intronic
900781021 1:4617256-4617278 TTGCAGGAATCGAGGCAGTGGGG + Intergenic
901378093 1:8854184-8854206 GTGCAGTCATGGTGGCAGTGGGG + Intergenic
905249232 1:36637441-36637463 TTGCATCCTACGTTGTAGTGGGG + Intergenic
906033384 1:42736815-42736837 TGGCAGCCCAAGTGGCATTGGGG + Intronic
915468740 1:156113576-156113598 TTGCAGCCAGCAAGGCTGTGGGG + Intronic
921544181 1:216454550-216454572 CTGCAGTCAAGGTGTCAGTGGGG + Intergenic
922856193 1:228776615-228776637 TTGCAAACAACGGAGCAGTGTGG - Intergenic
923495264 1:234519227-234519249 CTGCAGCCACCGCGGGAGTGAGG + Intergenic
1065883777 10:30059333-30059355 TTCCAGCCACCCTGGCGGTGGGG - Intronic
1067518947 10:46980348-46980370 ATACAGCCCACGTGGCAGAGAGG - Intronic
1067643299 10:48071486-48071508 ATACAGCCCACGTGGCAGAGAGG + Intergenic
1069084947 10:64128040-64128062 TTCCAGCCAACGAGCCAGTGAGG - Intergenic
1070660943 10:78304790-78304812 TGGCAGCCCAAGAGGCAGTGGGG + Intergenic
1074039065 10:109770172-109770194 TTGCAGCCAACACAGCACTGAGG - Intergenic
1074087424 10:110218900-110218922 TCGCTGCCACCGTGACAGTGTGG + Intronic
1077390181 11:2297173-2297195 CTGCAGCCAGGGTGTCAGTGTGG + Exonic
1079947706 11:26764650-26764672 TTCCAGCCAACCTGGCAAAGTGG + Intergenic
1081402355 11:42657957-42657979 TTGCTGCCTGAGTGGCAGTGAGG - Intergenic
1087088939 11:94248212-94248234 GTGCAGCCCACGTAGCAGGGTGG + Intergenic
1088699517 11:112399602-112399624 TTGCAGCCACCTTGGGAGTCTGG + Intergenic
1088794612 11:113257168-113257190 TTGCACCCTACTTGGCAGTGAGG - Intronic
1089772506 11:120813862-120813884 TTGCAGACAAGGATGCAGTGGGG + Intronic
1092912342 12:13157867-13157889 TTCCAGCCTGCGTGACAGTGAGG - Intergenic
1099102947 12:78465487-78465509 TTGCAGCAAAAGTCACAGTGGGG + Intergenic
1099441889 12:82708717-82708739 TTGCAGCTAAGGAGGCAGAGGGG - Intronic
1100087324 12:90927607-90927629 ATGAAGCCAACTTGGCTGTGTGG - Intronic
1100482081 12:94988849-94988871 CAGCAGACAACATGGCAGTGTGG - Intronic
1104181905 12:126390028-126390050 TTACACCCATCGTGGCATTGGGG - Intergenic
1105358057 13:19678231-19678253 TTGCAGACACAGTGGGAGTGAGG - Intronic
1105984446 13:25551561-25551583 TTGCAGCCATGGTTGAAGTGTGG + Intronic
1106029434 13:25986654-25986676 CTGCAGTGAACATGGCAGTGCGG + Intronic
1110666431 13:78122829-78122851 TTGCAGACAAAGTGGGAGAGAGG + Intergenic
1112898901 13:104335823-104335845 CTGGAGCCAACTTGGCTGTGAGG + Intergenic
1117638737 14:57774776-57774798 TTGCAGGCAAAGTGGCACAGGGG - Intronic
1120941547 14:89954871-89954893 TTGGAGCCGCCCTGGCAGTGAGG + Intergenic
1126189404 15:45864135-45864157 TTGCAGGCAAGATGTCAGTGAGG - Intergenic
1128881404 15:71246400-71246422 TCGCAGCTAACGTGGGACTGAGG - Intronic
1134225146 16:12384169-12384191 CTGCAGTAAACGTGGGAGTGTGG + Intronic
1136281925 16:29218345-29218367 TGGCACCCAGCCTGGCAGTGTGG + Intergenic
1142086301 16:88184261-88184283 TGGCACCCAGCCTGGCAGTGTGG + Intergenic
1144519680 17:15945397-15945419 CTGCGGCCGACGTGGCCGTGGGG + Exonic
1144624941 17:16839792-16839814 TGGCAGCAAACGTGGCTGTGGGG - Intergenic
1144881487 17:18432929-18432951 TGGCAGCAAACGTGGCTGTGGGG + Intergenic
1145150746 17:20511457-20511479 TGGCAGCAAACGTGGCTGTGGGG - Intergenic
1147261231 17:39210663-39210685 TGGCAGCAAACAGGGCAGTGTGG + Exonic
1147579087 17:41618490-41618512 TGGCAGCAAACGTGGCTGTGGGG - Intergenic
1147917650 17:43898324-43898346 CTGCAGCCCCCGTGGCACTGGGG + Exonic
1148722282 17:49763011-49763033 TTGCAGCCAACGTGGCAGTGGGG - Intronic
1155858916 18:30871694-30871716 TTGCAGCCAAGGTGTCAGCCAGG + Intergenic
1157657113 18:49401340-49401362 TTGCTGCCAAAGTGATAGTGTGG - Intronic
1160827124 19:1085799-1085821 TGGCAGCCACAGCGGCAGTGAGG + Exonic
1161458039 19:4379763-4379785 CAGCAGCCATCCTGGCAGTGAGG - Intronic
1165099927 19:33432981-33433003 CTGCAGGCAGCATGGCAGTGAGG - Intronic
1166290263 19:41859105-41859127 TTGCAGCCACAGTATCAGTGTGG + Intergenic
927981712 2:27378619-27378641 CTGCAGGCAAAGGGGCAGTGGGG + Exonic
929484264 2:42340417-42340439 TTGAACCCACAGTGGCAGTGTGG - Intronic
930885910 2:56326191-56326213 TTGCAGCCTACGTGACTTTGAGG + Intronic
937971196 2:127550705-127550727 TTTCAGGCAACTTGGCTGTGGGG + Intronic
938327571 2:130422059-130422081 ATACAGCCAAAGTGGCATTGAGG + Intergenic
938362375 2:130699419-130699441 ATACAGCCAAAGTGGCATTGAGG - Intergenic
941690464 2:168496026-168496048 TTGCATGCAAGGTTGCAGTGGGG - Intronic
943757211 2:191569214-191569236 TTTCAGCTGAGGTGGCAGTGGGG + Intergenic
945151861 2:206800182-206800204 GTAGAGCCAACATGGCAGTGAGG - Intergenic
948541289 2:238692987-238693009 TTTCAGCCATCGAGGCAGAGAGG - Intergenic
1175199530 20:57267788-57267810 CTGCACCCAGAGTGGCAGTGAGG + Intergenic
1175733035 20:61366998-61367020 TTGCAGGCAACGAGACAGCGGGG + Intronic
1177752970 21:25308821-25308843 TGGGAGCCAACTTGGCACTGTGG - Intergenic
1180696038 22:17752165-17752187 CTGCAGCCACCTTGGCACTGTGG + Intronic
1181305951 22:21917380-21917402 CTGCAGGCAAAGTGGGAGTGGGG + Intergenic
1184995954 22:48207738-48207760 TTGCAGCCCACATGGTAGCGAGG - Intergenic
1185020290 22:48370519-48370541 TTGCAGGGAACTTGGCAGGGAGG + Intergenic
1185393987 22:50577681-50577703 TGCCAGCCAAGGAGGCAGTGAGG + Intronic
953366317 3:42348453-42348475 CAGCAGCCAAGGTGGGAGTGGGG + Intergenic
954195958 3:48997395-48997417 CTGCAGCCAGCGTTGCAGGGTGG + Intronic
960004250 3:112765864-112765886 TTGCATCCAACTTGGGAGGGCGG - Intronic
963107590 3:141660117-141660139 TCGCAGCCAACGTCGCTGCGAGG - Intergenic
966440922 3:179943264-179943286 CAGCAGCCACCTTGGCAGTGGGG + Intronic
967202134 3:187081313-187081335 TTGCAGCCAAGATGGCAGCTAGG + Intergenic
971531965 4:27700309-27700331 TTGAAGAAAACGTGCCAGTGTGG - Intergenic
973127860 4:46610726-46610748 TTTCAGTCAACATGCCAGTGTGG - Intergenic
979557603 4:122067300-122067322 TAAAAGCCAGCGTGGCAGTGTGG - Intergenic
982693972 4:158579205-158579227 CTGCAACCAAGGTGTCAGTGGGG - Intronic
985913225 5:2898746-2898768 GTGCAGCCAGCGTGGCTCTGGGG + Intergenic
990741285 5:58915240-58915262 TTGCACCCAGCGGGGCATTGTGG - Intergenic
991923926 5:71684677-71684699 TTACAGTGAAGGTGGCAGTGGGG - Intergenic
998015227 5:138726331-138726353 TCTCAGCCAACTTGGCAGTCAGG - Intronic
1000289309 5:159855307-159855329 TGGCATCCAACATGGCAGAGAGG + Intergenic
1001143938 5:169167808-169167830 GTGCAGCCAGAGTGTCAGTGAGG - Intronic
1005793980 6:29337657-29337679 TTACAGCCAACATGGAAGTAAGG + Intergenic
1006378860 6:33686277-33686299 TGGCAGCCAGGGTGGCAGTGTGG + Intronic
1011970739 6:93219757-93219779 TTCCAGCTGACATGGCAGTGTGG + Intergenic
1018050614 6:160005510-160005532 TGGCCGCCAGCGTGGCCGTGCGG + Intronic
1019318113 7:400906-400928 TGGGACCCAACGTGGCACTGAGG + Intergenic
1026110539 7:67455549-67455571 TTGCAGCCAATGGGGTAGGGAGG - Intergenic
1033649677 7:143331304-143331326 TTGCTGCCATCGGGTCAGTGGGG + Exonic
1034581785 7:152050111-152050133 TTGCAGCCTAGGTATCAGTGTGG - Intronic
1035395440 7:158531840-158531862 TTGGAGCCAGCGTGGCTGGGAGG - Intronic
1039256623 8:35725997-35726019 TAGCACCCAACCTGGCAGGGTGG + Intronic
1039849235 8:41348042-41348064 ATGCAGCCACGGTGGGAGTGTGG + Intergenic
1041017653 8:53607811-53607833 ATGCAGCCACAGCGGCAGTGAGG + Intergenic
1044662673 8:94606544-94606566 TGCCAGCCAACCTGGCAGGGTGG - Intergenic
1046097088 8:109575140-109575162 TTGCAGCCTGCGTGGAAGAGAGG - Exonic
1048888503 8:138928148-138928170 GTGCAGCGCACCTGGCAGTGAGG - Intergenic
1050667989 9:7963186-7963208 TTGCTGCCAAGTTGGCATTGAGG - Intergenic
1051742837 9:20268021-20268043 TAGCAGATAACGTGGCTGTGGGG - Intergenic
1052792869 9:32892700-32892722 TTCCAGCCCAAGTGACAGTGAGG + Intergenic
1053536450 9:38931288-38931310 GTGCAGTGAACGTGGCAGTGTGG + Intergenic
1054629684 9:67432660-67432682 GTGCAGTGAACGTGGCAGTGTGG - Intergenic
1057410263 9:94811537-94811559 TTGAAGCCAAAGTGGTGGTGGGG - Intronic
1061236926 9:129348769-129348791 TGGCTTCCAACCTGGCAGTGCGG - Intergenic
1062318812 9:135980621-135980643 CTGCAGCCACTGTGGGAGTGAGG - Intergenic
1189763425 X:44344969-44344991 TTGAGGCCAGCGTGGGAGTGGGG + Intergenic
1190328209 X:49219548-49219570 GAGCAGCCAAGGTGGGAGTGGGG - Intronic
1191130463 X:57002913-57002935 TTGCAGTCAGTGTGGCACTGGGG - Intergenic
1194290479 X:92065291-92065313 TTGCAACAAACATGGGAGTGCGG + Intronic
1200607991 Y:5289890-5289912 TTGCAACAAACATGGGAGTGCGG + Intronic