ID: 1148722283

View in Genome Browser
Species Human (GRCh38)
Location 17:49763012-49763034
Sequence ATTGCAGCCAACGTGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 84}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722283_1148722290 2 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722283_1148722287 -1 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722283_1148722292 3 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722283_1148722296 14 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409
1148722283_1148722295 11 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 228
1148722283_1148722298 17 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722298 17:49763052-49763074 CTTGGTGGGTAGAGGGGTGGAGG 0: 1
1: 0
2: 4
3: 78
4: 809
1148722283_1148722294 10 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722294 17:49763045-49763067 AAACAGCCTTGGTGGGTAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 391
1148722283_1148722293 9 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722293 17:49763044-49763066 AAAACAGCCTTGGTGGGTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 236
1148722283_1148722299 18 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722283 Original CRISPR ATTGCAGCCAACGTGGCAGT GGG (reversed) Intronic
900336778 1:2168200-2168222 TTTCCAGCCACCGTGGCAGAGGG - Intronic
900781020 1:4617255-4617277 ATTGCAGGAATCGAGGCAGTGGG + Intergenic
912487691 1:110042034-110042056 ATTGCAGCCAACGAGGACATAGG + Intronic
915681611 1:157586755-157586777 ATAGCAGCCATCATGGCACTAGG + Intronic
918518601 1:185389532-185389554 GTTGCAGTCAAAGTGTCAGTCGG + Intergenic
1063575691 10:7260108-7260130 ATTGCTGCCATAGTGGTAGTAGG - Intronic
1068895165 10:62190855-62190877 ATTGAAGCAAATGTGGCAGTAGG - Intronic
1073229113 10:101952071-101952093 AATGCAGCCAACTTGAAAGTTGG - Intronic
1075569674 10:123530698-123530720 ATTGCAGGAAATGTGGCTGTGGG + Intergenic
1076384266 10:130045639-130045661 AATGCAGCCAAGGTGTCAATAGG + Intergenic
1079257892 11:18848430-18848452 ATTGCCCCCAAAGTGGCAGCAGG + Intergenic
1082612978 11:55324928-55324950 ATCACAGCTAATGTGGCAGTTGG + Intergenic
1084995337 11:72971723-72971745 AATGCAGCCAAGGTGACATTTGG + Intronic
1095985476 12:47996505-47996527 TTTGCAGCCAAAATGGCAGGAGG - Intronic
1096607804 12:52778906-52778928 ATTCCAGCCAAACTGGCAGTGGG + Intergenic
1097909926 12:64958740-64958762 ATTGCAGCCAACATTACAGCTGG - Intergenic
1102574598 12:113848385-113848407 ATTCCAGCCACCCAGGCAGTGGG - Intronic
1102625313 12:114230780-114230802 ACTGCAGTCAATGTGGCAGCTGG + Intergenic
1102733459 12:115135872-115135894 ATTGCAGCCAATGGGGGACTTGG + Intergenic
1104181906 12:126390029-126390051 ATTACACCCATCGTGGCATTGGG - Intergenic
1107198802 13:37688214-37688236 ATTGCTGACACCGTGGCAGAGGG + Intronic
1111810915 13:93094350-93094372 ATTGCTCCCAATGTTGCAGTGGG + Intergenic
1118124673 14:62888463-62888485 ATTACACCTAACCTGGCAGTGGG + Intronic
1129590676 15:76912228-76912250 ATTCCAGCCCAGGTGACAGTGGG - Intergenic
1131829517 15:96345130-96345152 ATTGTAGGAAACGTGGCTGTAGG + Intergenic
1135680217 16:24450113-24450135 ATTGCAGCCCAAGATGCAGTGGG - Intergenic
1144624942 17:16839793-16839815 GTGGCAGCAAACGTGGCTGTGGG - Intergenic
1144881486 17:18432928-18432950 GTGGCAGCAAACGTGGCTGTGGG + Intergenic
1145150747 17:20511458-20511480 GTGGCAGCAAACGTGGCTGTGGG - Intergenic
1147579088 17:41618491-41618513 GTGGCAGCAAACGTGGCTGTGGG - Intergenic
1148722283 17:49763012-49763034 ATTGCAGCCAACGTGGCAGTGGG - Intronic
1162412261 19:10513722-10513744 AATGCAGCCAAAGGTGCAGTCGG - Exonic
1165198626 19:34127155-34127177 ACTGCAGCTGACGTGGCTGTGGG + Intergenic
1168330621 19:55565768-55565790 AGTGCAGCCCACGGGGCATTTGG - Intergenic
1168501135 19:56894524-56894546 ATTTCAGCAAAAGTCGCAGTTGG + Intergenic
929929490 2:46241303-46241325 ATTGCAGTCAAGATGTCAGTAGG + Intergenic
929937908 2:46307982-46308004 AGGGCAGCCACCATGGCAGTGGG + Intronic
937750346 2:125469840-125469862 ATTGCAGCCCAAGAGGCAGCAGG - Intergenic
938146551 2:128839285-128839307 AGAGCAGCCAAGGAGGCAGTAGG + Intergenic
938927911 2:136061232-136061254 ATTTCAGGCAAGGTGGCACTGGG - Intergenic
941986288 2:171514869-171514891 ATTTCAGCCTAGGTGACAGTGGG + Intergenic
944074161 2:195709055-195709077 ATTGCAGCCTAGGTGACAGAGGG - Intronic
1170137009 20:13085808-13085830 ATGGCAGCAAATGTGGCACTTGG + Intronic
1170795652 20:19544749-19544771 ATTGGATCCAAGATGGCAGTTGG + Intronic
1172139996 20:32715874-32715896 ATTACAGATAACTTGGCAGTAGG - Intronic
1173776651 20:45714237-45714259 GTTCCAGCCACAGTGGCAGTAGG + Intergenic
1175733034 20:61366997-61367019 ATTGCAGGCAACGAGACAGCGGG + Intronic
1176152291 20:63598028-63598050 ACTGCAGCCACCGTGCCTGTGGG - Intronic
1177344666 21:19854000-19854022 ACTGTAGGCAACGTAGCAGTAGG - Intergenic
1181392070 22:22590613-22590635 ATTGCAGCCAAGCTGTCAGGCGG + Intergenic
1183116383 22:35695546-35695568 ATTACAGCCAATATCGCAGTGGG - Intergenic
1183829542 22:40410477-40410499 ACTGCAGCCAGCGTGGCCCTAGG - Exonic
1184514402 22:44953059-44953081 ACTGAAGCCATCGTAGCAGTTGG - Intronic
950678324 3:14568097-14568119 ACTGCAGCCAACCTGGCCCTTGG - Intergenic
951654131 3:24985822-24985844 ATGGCTGCCAACGCGGCAGCAGG - Intergenic
952747092 3:36791710-36791732 ATTGCAGCCCAAGATGCAGTGGG - Intergenic
956119189 3:65949099-65949121 ATTGCTGCCAACATGACATTTGG + Intronic
979753649 4:124311474-124311496 ATTGCAACCAACATGTCAGCTGG - Intergenic
981632800 4:146840645-146840667 ATTGCAGCCTACGTTGTATTTGG + Intronic
983479927 4:168260506-168260528 ATGGAAGACAACTTGGCAGTGGG + Intronic
988424191 5:31043730-31043752 ATGGCAGCCTACATGGTAGTTGG - Intergenic
990750115 5:59005510-59005532 ATAGCAGCTACCGTGGCAATAGG - Intronic
991961560 5:72049645-72049667 CTTGCAGCCAGAGTGACAGTGGG - Intergenic
994000196 5:94770568-94770590 ATTCCCTCCAAAGTGGCAGTTGG - Intronic
995419956 5:111953294-111953316 ATTGCAGCAAACATGGCAGTGGG + Intronic
998075617 5:139233782-139233804 ATTCCAGCCTACGTGGCAGAGGG + Intronic
1001133248 5:169081316-169081338 AGTGCAGCCAGCGGGGCAGCTGG + Intronic
1002320817 5:178374681-178374703 ATTGCAGCCATCCTAGCAGGTGG - Intronic
1011600535 6:89055964-89055986 ATTCCAGCCTAGGTGGCAGAAGG - Intergenic
1012309197 6:97700358-97700380 TTTGGTGGCAACGTGGCAGTAGG - Intergenic
1017507747 6:155083956-155083978 AGTACAGCCAACGTGACACTAGG - Intronic
1021551394 7:21874593-21874615 ATTCCAGCCAAGGTGGAATTGGG - Intronic
1023916803 7:44596081-44596103 AGTGCAGCCCAAGAGGCAGTAGG - Intergenic
1036727957 8:11236966-11236988 ATTGCAGTCAAGATGTCAGTAGG - Intergenic
1036777518 8:11623792-11623814 ATTGCAGACAAAGTGCCTGTTGG - Intergenic
1040641476 8:49339536-49339558 ATTCCAGACAAGGTGTCAGTTGG + Intergenic
1041410611 8:57550147-57550169 AGTGCAGCCAACCTGGTAGACGG + Intergenic
1044464501 8:92487775-92487797 ATGGCAGCCACCAGGGCAGTTGG - Intergenic
1045674253 8:104589669-104589691 AGTGCGGCCAACCTGGCAGCTGG + Intergenic
1046058219 8:109104110-109104132 ATAGCAGGCTACCTGGCAGTGGG - Intronic
1046939327 8:119915769-119915791 ATTCCAGCAAACCTCGCAGTAGG + Intronic
1047736301 8:127768152-127768174 ATTGCAACCAAGGAGGGAGTGGG - Intergenic
1049606776 8:143533189-143533211 GATGCAGCCAACGGGGCAGAGGG - Intronic
1051742838 9:20268022-20268044 ATAGCAGATAACGTGGCTGTGGG - Intergenic
1059994827 9:119898602-119898624 AGTGCAGCCAAGGTGGCTCTAGG - Intergenic
1187178574 X:16919754-16919776 ATTGAAGCTAACATGGCAGAAGG + Intergenic
1187792168 X:22962877-22962899 ATTGCTTCCAACGTGGGAGGAGG - Intergenic
1191130464 X:57002914-57002936 ATTGCAGTCAGTGTGGCACTGGG - Intergenic
1195405991 X:104513946-104513968 ATTCCAGCCAACTTGGCATCTGG + Intergenic