ID: 1148722284

View in Genome Browser
Species Human (GRCh38)
Location 17:49763013-49763035
Sequence CATTGCAGCCAACGTGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 161}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722284_1148722296 13 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409
1148722284_1148722299 17 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652
1148722284_1148722295 10 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 228
1148722284_1148722294 9 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722294 17:49763045-49763067 AAACAGCCTTGGTGGGTAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 391
1148722284_1148722292 2 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722284_1148722290 1 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722284_1148722293 8 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722293 17:49763044-49763066 AAAACAGCCTTGGTGGGTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 236
1148722284_1148722287 -2 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722284_1148722298 16 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722298 17:49763052-49763074 CTTGGTGGGTAGAGGGGTGGAGG 0: 1
1: 0
2: 4
3: 78
4: 809

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722284 Original CRISPR CATTGCAGCCAACGTGGCAG TGG (reversed) Intronic
900336779 1:2168201-2168223 CTTTCCAGCCACCGTGGCAGAGG - Intronic
900487839 1:2931873-2931895 CACTGCACCCCACCTGGCAGGGG - Intergenic
900781019 1:4617254-4617276 CATTGCAGGAATCGAGGCAGTGG + Intergenic
900939389 1:5788260-5788282 CAGTGTAGCCAGCATGGCAGGGG - Intergenic
900960610 1:5916996-5917018 GAGTGCAGCCAAAGCGGCAGTGG + Intronic
900985228 1:6069291-6069313 CATTGGAGCCACCTGGGCAGAGG - Intronic
902223114 1:14979373-14979395 CATTCCAGCCTGGGTGGCAGAGG + Intronic
903550190 1:24152715-24152737 CTCGGCAGCCCACGTGGCAGTGG + Intergenic
905745393 1:40412827-40412849 CATTGAGGCCAATGTGGAAGAGG + Intronic
906082879 1:43105818-43105840 CATTCCAGCCTGGGTGGCAGCGG - Intergenic
906469737 1:46118587-46118609 CATTCCAGCCTGGGTGGCAGAGG - Intronic
910087035 1:83415761-83415783 CAGGGAAGCCAATGTGGCAGAGG + Intergenic
910901824 1:92129450-92129472 CATTCCAGCCAGGGTGACAGAGG + Intronic
916523212 1:165584476-165584498 AATTGCAGCCAACCAGGAAGAGG + Intergenic
916921977 1:169478385-169478407 CATTCCAGCCTAGGTGACAGAGG - Intronic
919561462 1:199125277-199125299 CATTTGAGCCCAGGTGGCAGAGG + Intergenic
923738257 1:236632321-236632343 CATTGCAGCCACCTTGGCTGAGG + Intergenic
1064870890 10:19935533-19935555 CATTGCAGCCAAAGAGGAAGTGG - Intronic
1067667148 10:48288347-48288369 CACCTGAGCCAACGTGGCAGGGG - Intergenic
1071285617 10:84141493-84141515 CCTTGCAGCCAACATGGTGGTGG - Exonic
1071696946 10:87886606-87886628 CATAGCAGCAAACGTTGCAAAGG - Intronic
1071794787 10:88992364-88992386 CAAAGCAGCCAACATTGCAGTGG - Intronic
1075729984 10:124630328-124630350 CACTGAAGCCCAGGTGGCAGAGG + Intronic
1077048991 11:558341-558363 CCTTGGGGCCAAGGTGGCAGTGG - Intronic
1081740262 11:45434634-45434656 CAGAGCAGCCAGCGTGGCACTGG + Intergenic
1083844289 11:65321871-65321893 CAGGGCATCCAACGGGGCAGAGG - Exonic
1084538359 11:69771945-69771967 CATTGAAGCAACCGTGGAAGAGG - Exonic
1086373461 11:86177212-86177234 CACTGCAGCCTGGGTGGCAGAGG + Intergenic
1087043574 11:93825199-93825221 CACTCCAGCCTAGGTGGCAGAGG - Intronic
1088920149 11:114254735-114254757 CATTACAGCCAAGCCGGCAGAGG - Intergenic
1089287174 11:117415054-117415076 AGTTGCAGCCACAGTGGCAGAGG + Intergenic
1090358503 11:126156650-126156672 CATTCCAGCCTGGGTGGCAGAGG + Intergenic
1096607803 12:52778905-52778927 AATTCCAGCCAAACTGGCAGTGG + Intergenic
1099376854 12:81902947-81902969 CACTGCAGTTAAGGTGGCAGGGG + Intergenic
1100607758 12:96165816-96165838 CATTGCTTCCCACGAGGCAGGGG + Intergenic
1101001326 12:100361124-100361146 CATTGCAGCCAAGTTGCCTGAGG - Intronic
1101589143 12:106110973-106110995 CACAGCAGCCAATGTGGGAGAGG - Intronic
1101813639 12:108129363-108129385 CAAGGCAGCCAAGGAGGCAGCGG + Intergenic
1102470725 12:113158412-113158434 AATCCCAGCTAACGTGGCAGAGG - Exonic
1102574599 12:113848386-113848408 CATTCCAGCCACCCAGGCAGTGG - Intronic
1107198801 13:37688213-37688235 TATTGCTGACACCGTGGCAGAGG + Intronic
1107735614 13:43395804-43395826 CATCGCAGCCTACGTGGCATGGG - Intronic
1107913573 13:45127407-45127429 CACTGCAGCCCAGGAGGCAGAGG - Intronic
1111258984 13:85710370-85710392 CATTCCAGCCCAGGTGACAGAGG - Intergenic
1111888154 13:94049213-94049235 CACTGCAGCCTAGGTGACAGAGG + Intronic
1112358003 13:98690781-98690803 CAGTGCAGCCAACGTTGCACAGG - Intronic
1113031775 13:106001178-106001200 CATTTCAGCCCAGGAGGCAGAGG - Intergenic
1114160854 14:20165413-20165435 CTTGGCAGCCAATGTGGCATGGG + Intergenic
1114323517 14:21567084-21567106 GATTGCAGCCCAGGAGGCAGAGG - Intergenic
1116905787 14:50402113-50402135 CACTGCAACCCAGGTGGCAGAGG + Intronic
1117224968 14:53647231-53647253 CATTTCAGTCAAAGGGGCAGGGG - Intergenic
1120753195 14:88217385-88217407 CATTGCACCCAAAGAGGCAGGGG - Intronic
1123396032 15:19936891-19936913 CACTCCAGCCAAGGTGACAGAGG + Intergenic
1125753982 15:42049783-42049805 CATAGCAGCCAGAGGGGCAGAGG + Intronic
1126675329 15:51155616-51155638 CAGGCCAGCCAACCTGGCAGGGG - Intergenic
1128035034 15:64517341-64517363 CATTCCAGCCTAGGTGACAGAGG + Intronic
1129079445 15:73026058-73026080 CATTTCAGCCCAGGGGGCAGAGG - Intergenic
1129590677 15:76912229-76912251 CATTCCAGCCCAGGTGACAGTGG - Intergenic
1130396027 15:83502330-83502352 CATTACACCAAACATGGCAGTGG - Intronic
1135521408 16:23181543-23181565 CACTCCAGCCAAGGTGACAGAGG + Intergenic
1139388405 16:66589223-66589245 CAGTCCAGCCATCCTGGCAGGGG + Intergenic
1141655922 16:85416507-85416529 CACCGCATCCCACGTGGCAGGGG - Intergenic
1141930794 16:87201482-87201504 CATTGCAACCCAGGAGGCAGAGG - Intronic
1142740507 17:1929246-1929268 CATACCAGCCAAGGAGGCAGTGG - Intergenic
1144740295 17:17578201-17578223 CATTCCAGCCTGGGTGGCAGAGG - Intronic
1146311106 17:31768999-31769021 CACTGCAGTTAAGGTGGCAGGGG + Intergenic
1146584994 17:34074817-34074839 CATTGCAGCCTGGGTGGCTGAGG - Intronic
1147859248 17:43507846-43507868 CACTGCATCCAAGGTGGCTGAGG - Exonic
1147886979 17:43690893-43690915 CCCAGCAGCCAAGGTGGCAGAGG + Intergenic
1148443182 17:47722227-47722249 CACAGCAGCCACTGTGGCAGTGG - Intergenic
1148722284 17:49763013-49763035 CATTGCAGCCAACGTGGCAGTGG - Intronic
1151582764 17:74989370-74989392 CATTTCAGCCAAGGAGGCTGAGG - Intronic
1152199706 17:78938215-78938237 CCTTTCAGCCAATGTGGAAGTGG + Intergenic
1152346900 17:79758203-79758225 CATTCCAGCCTTGGTGGCAGCGG + Intergenic
1154041686 18:10861932-10861954 CACTGGAACCAACGAGGCAGAGG + Intronic
1154065900 18:11106700-11106722 CACTGCACCCAGCTTGGCAGTGG + Intronic
1155053367 18:22166333-22166355 CACTGCAGCCAATTGGGCAGGGG - Intergenic
1156161775 18:34368105-34368127 CATTGCTACCAATGTGGAAGAGG - Intergenic
1158510311 18:58084726-58084748 CATTCCAGCCTAGGTGACAGAGG - Intronic
1159436892 18:68429708-68429730 CATTGCTGCCACTGAGGCAGAGG - Intergenic
1162574705 19:11492381-11492403 CATTCCAGCCTAGGTGACAGAGG - Intronic
1163213684 19:15860561-15860583 CACTGCAGCCTGGGTGGCAGAGG + Intergenic
1165198625 19:34127154-34127176 CACTGCAGCTGACGTGGCTGTGG + Intergenic
930027057 2:47035366-47035388 CCTTGCAAGCCACGTGGCAGAGG + Intronic
930646300 2:53912489-53912511 CACTGCAGCCTGGGTGGCAGAGG - Intronic
930768624 2:55110275-55110297 CATTCCAGCCTAGGTGACAGAGG + Intronic
931001037 2:57782310-57782332 CACTGCATCCCAGGTGGCAGAGG + Intergenic
933758411 2:85658585-85658607 CACTGCAGCCCAGGAGGCAGAGG - Exonic
934766372 2:96882377-96882399 CCTTCCCTCCAACGTGGCAGGGG + Intronic
937023300 2:118677876-118677898 CTTTGCAGCCTATGTGGCAGAGG - Intergenic
937871781 2:126791398-126791420 GATTGCAGCCCAAGAGGCAGCGG - Intergenic
938927912 2:136061233-136061255 CATTTCAGGCAAGGTGGCACTGG - Intergenic
939174151 2:138730226-138730248 CATTCCAGCCTAGGTGACAGAGG - Intronic
940233394 2:151483215-151483237 CTTTGCAGCCTACGTGGTAGTGG + Intronic
941986287 2:171514868-171514890 CATTTCAGCCTAGGTGACAGTGG + Intergenic
944074162 2:195709056-195709078 CATTGCAGCCTAGGTGACAGAGG - Intronic
945300837 2:208215003-208215025 CATTCCAGCCTGGGTGGCAGAGG + Intergenic
947031293 2:225798917-225798939 CATTTCAGCCAGTGTGGAAGGGG - Intergenic
1168942024 20:1720885-1720907 CACTGCAGCCTATGTGACAGAGG + Intergenic
1171101577 20:22388648-22388670 CATTCCAGCCTAGGTGACAGAGG + Intergenic
1172126005 20:32625810-32625832 CACTGCAGCCTAAGTGACAGAGG + Intergenic
1173590135 20:44218364-44218386 TATTGCAGCCAATGTTGCAATGG - Intergenic
1175733033 20:61366996-61367018 CATTGCAGGCAACGAGACAGCGG + Intronic
1176152292 20:63598029-63598051 CACTGCAGCCACCGTGCCTGTGG - Intronic
1178286287 21:31328101-31328123 CATTGGAGCCAAGATGGCAAGGG - Intronic
1183087413 22:35495019-35495041 CATTGCATCCAATGTTGCAATGG + Intergenic
1183783761 22:40017310-40017332 CATTGCAACCCAGGAGGCAGGGG - Intronic
949680871 3:6512955-6512977 TATTACAGCCGAAGTGGCAGGGG - Intergenic
950411704 3:12842292-12842314 CATTCCAGCCTAGGTGACAGAGG - Intronic
952626794 3:35415550-35415572 CATTGCAGCCAAAGTAGTTGAGG + Intergenic
953708631 3:45250589-45250611 CATTTCAGCAGACATGGCAGAGG - Intergenic
954533581 3:51341315-51341337 CATCGCAGACAGAGTGGCAGCGG + Exonic
954713494 3:52516162-52516184 CATGGAAGCCCTCGTGGCAGTGG - Exonic
955536612 3:59930274-59930296 CATTGCAGCCATGGTGGGTGGGG + Intronic
956333178 3:68133796-68133818 CATGGATGCCAAAGTGGCAGAGG + Intronic
957194572 3:77050982-77051004 CATTCCAGCCAGGGTGACAGAGG + Intronic
959123164 3:102257160-102257182 CACTGCAGCCTGGGTGGCAGAGG + Intronic
962473115 3:135731396-135731418 CATTACAGCCAATCTGGCAAGGG + Intergenic
962938325 3:140102202-140102224 CATTGCTGCCTCCTTGGCAGGGG + Intronic
964361643 3:155904321-155904343 CACTCCAGCCCAGGTGGCAGAGG - Intronic
968929353 4:3570364-3570386 CAATCCAGCCAACGTGGGAGAGG + Intergenic
972630978 4:40841710-40841732 CATTCCAGCCAGGGTGACAGAGG - Intronic
978608101 4:110504398-110504420 CATTGCAGCAGCCATGGCAGAGG + Intronic
983042267 4:162943764-162943786 CATTGCAGGCAAAATGGCATTGG - Intergenic
983479926 4:168260505-168260527 CATGGAAGACAACTTGGCAGTGG + Intronic
983717290 4:170798546-170798568 CACTGCAGCCTAGGTGACAGAGG + Intergenic
983801059 4:171930067-171930089 CCTAACAGCCAATGTGGCAGTGG + Intronic
985378245 4:189364995-189365017 CATTGTGTCCCACGTGGCAGGGG + Intergenic
986964953 5:13258778-13258800 CATTCCAGCCTAGGTGACAGAGG + Intergenic
991961561 5:72049646-72049668 CCTTGCAGCCAGAGTGACAGTGG - Intergenic
994089235 5:95794120-95794142 CTTGCCAGCCAAGGTGGCAGTGG - Exonic
995419955 5:111953293-111953315 CATTGCAGCAAACATGGCAGTGG + Intronic
996677753 5:126195998-126196020 CTTTGGGGCCAAAGTGGCAGTGG + Intergenic
997117581 5:131141882-131141904 CATTGCAGCCTGGGTGACAGAGG + Intergenic
997594869 5:135100443-135100465 AATTGCTGTCCACGTGGCAGGGG - Intronic
998075616 5:139233781-139233803 CATTCCAGCCTACGTGGCAGAGG + Intronic
1002502278 5:179654795-179654817 CACTGCAGCCTGCGTGACAGAGG - Intergenic
1003072246 6:2954082-2954104 CATTCCAGCCTAGGTGACAGAGG + Intronic
1004517250 6:16330669-16330691 CACTGCAGCCAGCTTGGAAGGGG + Intronic
1005522177 6:26611099-26611121 CACTCCAGCCTAGGTGGCAGAGG + Intergenic
1005610300 6:27517613-27517635 CATTCCAGCCTGCGTGACAGAGG - Intergenic
1008178436 6:48297721-48297743 CATTCCAGCCTAGGTGACAGAGG - Intergenic
1014990500 6:128069350-128069372 CTTAGCAACCAACTTGGCAGAGG - Intronic
1018211693 6:161488521-161488543 CACTTCAGCCTACGTGGCAGAGG - Intronic
1022060374 7:26787354-26787376 CACTCCAGCCTAGGTGGCAGAGG - Intronic
1024028330 7:45433201-45433223 CCATGCAGCCAGCTTGGCAGGGG + Intergenic
1026333439 7:69373175-69373197 CATTCCAGCCTTAGTGGCAGAGG + Intergenic
1026477357 7:70748444-70748466 CTTTGCAGCCATCATGGCTGGGG + Intronic
1027035998 7:74925773-74925795 CACTCCAGCCTGCGTGGCAGTGG + Intergenic
1027303919 7:76872247-76872269 CAGGGAAGCCAATGTGGCAGAGG + Intergenic
1029117907 7:98247102-98247124 CACTGCAGCCTAGGTGACAGAGG + Intronic
1032904370 7:136347519-136347541 CCTTGCAGTCACCATGGCAGAGG + Intergenic
1035106113 7:156442687-156442709 CCCTGCAGCCAACGAGGCTGCGG - Intergenic
1037508276 8:19554882-19554904 CATTGCAGCCTGGGTGACAGAGG + Intronic
1038175527 8:25179075-25179097 CATTCCAGCCTAGGTGACAGGGG - Intergenic
1039369717 8:36972529-36972551 CATTGCAGCCAATTAGGCAGGGG + Intergenic
1042594418 8:70430594-70430616 CATGACAGCCAATGAGGCAGTGG - Intergenic
1044756420 8:95466901-95466923 CACTGCAGCCTAGGTGACAGAGG + Intergenic
1046837133 8:118814449-118814471 CATTCCAGCCTAGGTGACAGAGG + Intergenic
1047977535 8:130145923-130145945 CACTGAAGCCCATGTGGCAGAGG - Intronic
1049606777 8:143533190-143533212 GGATGCAGCCAACGGGGCAGAGG - Intronic
1053804046 9:41783801-41783823 CAATCCAGCCAACTTGGGAGAGG + Intergenic
1054141236 9:61531658-61531680 CAATCCAGCCAACATGGGAGAGG - Intergenic
1054192350 9:61995297-61995319 CAATCCAGCCAACGTGGGAGAGG + Intergenic
1054460927 9:65462094-65462116 CAATCCAGCCAACGTGGGAGAGG - Intergenic
1054646056 9:67593394-67593416 CAATCCAGCCAACGTGGGAGAGG - Intergenic
1061096327 9:128458876-128458898 CACTCCAGCCTAGGTGGCAGAGG - Intronic
1061402223 9:130374638-130374660 CATTGCAGCCAACGCTGTTGGGG + Intronic
1062700567 9:137899736-137899758 CATGGGAGCCAAGCTGGCAGGGG - Intronic
1186357400 X:8801683-8801705 CATTCTAGCCAAAGGGGCAGGGG - Intergenic
1186376309 X:9005369-9005391 CATTCCAGCCTAGGTGACAGAGG + Intergenic
1186378732 X:9034382-9034404 CATTCTAGCCAAAGGGGCAGGGG - Intronic
1186618349 X:11213185-11213207 CATTGCACCCAAAGGGGCAAGGG - Intronic
1186618482 X:11214452-11214474 CATTGCATCCAAAGGGGTAGGGG + Intronic
1186917163 X:14235229-14235251 CATTTCAGCCAGAGTGGGAGGGG - Intergenic
1187565163 X:20442607-20442629 CAGTGCAGCCAAAGTGCCATGGG + Intergenic
1189097007 X:38151208-38151230 CACTGCAGGAAACCTGGCAGAGG - Intronic
1191130465 X:57002915-57002937 CATTGCAGTCAGTGTGGCACTGG - Intergenic
1191869237 X:65731575-65731597 TATGGCAGCCAACATGCCAGAGG + Intronic
1193691371 X:84648683-84648705 CAAGGCAGCCAATGTGGCTGAGG + Intergenic