ID: 1148722285

View in Genome Browser
Species Human (GRCh38)
Location 17:49763019-49763041
Sequence CCGGGGCATTGCAGCCAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722285_1148722301 29 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722301 17:49763071-49763093 GAGGGAGTAGAAAGAAAGGTAGG 0: 1
1: 0
2: 6
3: 102
4: 1051
1148722285_1148722287 -8 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722285_1148722290 -5 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722285_1148722292 -4 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722285_1148722298 10 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722298 17:49763052-49763074 CTTGGTGGGTAGAGGGGTGGAGG 0: 1
1: 0
2: 4
3: 78
4: 809
1148722285_1148722294 3 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722294 17:49763045-49763067 AAACAGCCTTGGTGGGTAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 391
1148722285_1148722302 30 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722302 17:49763072-49763094 AGGGAGTAGAAAGAAAGGTAGGG 0: 1
1: 0
2: 6
3: 112
4: 1145
1148722285_1148722299 11 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652
1148722285_1148722300 25 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722300 17:49763067-49763089 GGTGGAGGGAGTAGAAAGAAAGG 0: 1
1: 0
2: 10
3: 92
4: 912
1148722285_1148722296 7 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409
1148722285_1148722293 2 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722293 17:49763044-49763066 AAAACAGCCTTGGTGGGTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 236
1148722285_1148722295 4 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722285 Original CRISPR CCGGGGCATTGCAGCCAACG TGG (reversed) Intronic
914431736 1:147624884-147624906 CCGGGGCATGGCTGCTGACGTGG + Exonic
1063152947 10:3353411-3353433 CCGGGGCTTTGCTGCCAAAGAGG + Intergenic
1064139691 10:12779978-12780000 TCGTGGCTTTGCAGCCAACATGG - Intronic
1074206162 10:111284761-111284783 CTGGGGCATTGCATCCTACAAGG - Intergenic
1076215594 10:128691068-128691090 CAGGGGCATTGCTGCTAATGAGG - Intergenic
1076723893 10:132404646-132404668 CTGGGGCAGCGGAGCCAACGGGG - Exonic
1077143430 11:1034785-1034807 CCGGGGCAGTGAAGCCAGCCTGG - Intronic
1079247712 11:18765304-18765326 CCAAGCCATTGCAGCCACCGTGG - Intronic
1084843018 11:71873272-71873294 CCTGTGGATTGCAGCCAAAGTGG - Intronic
1087549397 11:99628486-99628508 ACGGTACATTGCAGCCAACTGGG - Intronic
1088810662 11:113389493-113389515 CCGGGAGATTGCAGCCTAGGGGG + Intronic
1089056929 11:115593250-115593272 CCTGGCCATTGGAGCCAATGAGG - Intergenic
1090001204 11:122960400-122960422 CAGGGGTATTGCAGGCAACAAGG + Intergenic
1090231699 11:125111595-125111617 CCGGCGCGTTCCAGCCCACGGGG + Exonic
1095584648 12:43836378-43836400 CCTGGGGATGGCAGCCAAAGAGG + Intronic
1101692818 12:107097183-107097205 CAGGGGCATAGCTGCCAAAGAGG + Intergenic
1103873203 12:124106157-124106179 CCCAGGCATTCCAGCCAACAAGG - Intronic
1104654972 12:130567676-130567698 CCTGGGCATAGCAGCCACAGCGG + Intronic
1107826125 13:44330506-44330528 CCAGGGCAGTCCAGGCAACGTGG - Intergenic
1112489628 13:99849831-99849853 CCAGGGCAAGGCAGCCAAGGAGG + Intronic
1113784259 13:112994188-112994210 CAGGGGCGTGGCTGCCAACGGGG + Intronic
1120163801 14:81172780-81172802 CTGTGGCCTTGCAGCCAACCTGG - Intergenic
1127225076 15:56919231-56919253 CCGGGGCAGGGCAGCAAAAGTGG + Intronic
1128236738 15:66072861-66072883 CCGGGGCCTTGCAGACAGTGGGG - Intronic
1129182480 15:73886025-73886047 CCGGTGCCTTGAAGCCAAGGGGG + Intronic
1129342198 15:74893338-74893360 CCAGAGCATTGCACCCAACCAGG - Intronic
1129672374 15:77614400-77614422 CCTGTGCATCGCGGCCAACGCGG - Exonic
1134649890 16:15899965-15899987 CTGTGGCATTGCAGCCTATGTGG + Intergenic
1138254641 16:55544717-55544739 CCAGGGAAATGCAGCCAAAGAGG - Intronic
1140535918 16:75709720-75709742 CAGGGGTATTGCAGGCAACAAGG - Intronic
1142214419 16:88823722-88823744 CCCGGGCATTGCCGCCTGCGAGG - Intronic
1142214432 16:88823764-88823786 CCCGGGCATTGCCGCCTGCGAGG - Intronic
1148722285 17:49763019-49763041 CCGGGGCATTGCAGCCAACGTGG - Intronic
1148862951 17:50614073-50614095 CAGGAGCATGGCAGCCCACGAGG + Intronic
1150225576 17:63523030-63523052 GCGGGGCCTTGCATCCTACGGGG - Intergenic
1152741550 17:82020641-82020663 CCCGGGCATGGCAGCCAGAGTGG - Intronic
1155147571 18:23096840-23096862 CTGGGGCATTGCTGGCATCGGGG - Intergenic
1165758812 19:38308994-38309016 CCGGGGCATTGACGTCAAAGCGG + Exonic
1167502226 19:49854742-49854764 CCGGGGCGTGGCAGCCAGGGCGG + Intronic
1168142899 19:54401145-54401167 ACGGTGCATAGCAGCCAAGGTGG + Intergenic
925447768 2:3942716-3942738 CCGGGGCCTTGCAGGCAGCACGG - Intergenic
938381093 2:130837061-130837083 CCGGGGCGCAGCAGCCAGCGCGG - Intronic
940393342 2:153159010-153159032 CAGGGGTATTGCAGGCAACAAGG + Intergenic
1176044768 20:63086834-63086856 CCGGGGCCCTGCAGCTCACGTGG + Intergenic
1183985422 22:41567487-41567509 CCAGAGCATTGCTGCCAAAGAGG - Intronic
1184592759 22:45496173-45496195 CCAGGGCATAGCAGCAAACGGGG + Intergenic
960084513 3:113576351-113576373 TTGGGGAATTTCAGCCAACGTGG + Intronic
969784106 4:9439330-9439352 CCTGTGGATTGCAGCCAAAGTGG - Intergenic
985896981 5:2754691-2754713 CCGCGGCCTTGCAGCCCTCGTGG - Intronic
988847374 5:35141819-35141841 CAGGGGCATGGCATCCAATGAGG - Intronic
997928822 5:138055458-138055480 CAGAGTCATTGCAGCCAATGGGG - Intergenic
1006181341 6:32154999-32155021 AGGGGGCAATGCAGCCACCGGGG - Intronic
1006512625 6:34529845-34529867 CCTGGGCATGGCAGGCACCGAGG + Intronic
1018860715 6:167708976-167708998 CCTGGGAATAGCAGCCAACAGGG + Intergenic
1024000780 7:45188107-45188129 CTGGGGCAGTCCAGGCAACGTGG + Intergenic
1030819948 7:114083579-114083601 CCGGGGCATGGCAGCAGGCGAGG + Intergenic
1032197742 7:129799144-129799166 CCAGGGCATGGCAGCCACCATGG - Intergenic
1037014077 8:13880940-13880962 TTGGGTCATTGCAGCCAAGGAGG + Intergenic
1037782853 8:21882607-21882629 CTGGGGCATTGCAACCAGCTGGG - Intergenic
1040295784 8:46148364-46148386 CTGGGGCTTTACAGCCCACGTGG + Intergenic
1042230462 8:66549158-66549180 ACGGGGCATTGCAGCCATGATGG - Intergenic
1049043366 8:140129472-140129494 CCAGGGCATCGGAGCCAAGGAGG + Intronic
1051350284 9:16192386-16192408 CCCGCGCAGTGCAGGCAACGGGG + Intergenic
1056221168 9:84451830-84451852 CTGATGCATTGCAGCCAACAGGG + Intergenic
1056455836 9:86758901-86758923 CCTGGGCACTGCAGCCAGAGAGG + Intergenic