ID: 1148722287

View in Genome Browser
Species Human (GRCh38)
Location 17:49763034-49763056
Sequence TGCCCCGGACAAAACAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 77}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722279_1148722287 6 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722284_1148722287 -2 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722282_1148722287 0 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722283_1148722287 -1 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722277_1148722287 27 Left 1148722277 17:49762984-49763006 CCACCATGCACTTGACTGTAGCC 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722281_1148722287 5 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722278_1148722287 24 Left 1148722278 17:49762987-49763009 CCATGCACTTGACTGTAGCCCTC 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148722285_1148722287 -8 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722287 Original CRISPR TGCCCCGGACAAAACAGCCT TGG Intronic
900565400 1:3329465-3329487 GGCCCCCGACACTACAGCCTGGG - Intronic
902393656 1:16120451-16120473 TGCTCCTGACACAACAGCCAGGG + Intergenic
911097836 1:94069704-94069726 TCCACTGGATAAAACAGCCTTGG + Intronic
913172339 1:116244070-116244092 TTCCCCAGAGAAATCAGCCTCGG - Intergenic
917795012 1:178527092-178527114 TGCCCTGGACTAAACATCCCTGG + Intronic
918444236 1:184600658-184600680 TTCCCTGGACAAAAGAGCATTGG + Intronic
919906998 1:202085179-202085201 AGCCCCTGACAACACAGCATTGG - Intergenic
920387328 1:205578285-205578307 TTCCCTGGACAAGACAGACTAGG - Intronic
924508116 1:244704989-244705011 TGGTCCAGAAAAAACAGCCTGGG - Intronic
1063515004 10:6687200-6687222 GGCACTGGCCAAAACAGCCTGGG - Intergenic
1069019103 10:63465811-63465833 TGCCCCGGACACAGCGACCTCGG + Exonic
1074662119 10:115672280-115672302 TGCCCTAGATTAAACAGCCTAGG + Intronic
1075940577 10:126387807-126387829 TGCCCCGGAGGGCACAGCCTCGG - Intronic
1076345681 10:129777493-129777515 TTCCCCGGAGAACACAGCCACGG - Intergenic
1077474987 11:2782118-2782140 TGCCCAAGACAAAAAAGCCTTGG - Intronic
1078479218 11:11661502-11661524 TGCCTCGGACTAATGAGCCTGGG - Intergenic
1080792635 11:35535515-35535537 TGCACAGGCCACAACAGCCTAGG + Intergenic
1102005280 12:109585809-109585831 TGGCGCAGTCAAAACAGCCTGGG - Intronic
1102157897 12:110745071-110745093 TGCCCAGCAGAAAACAACCTGGG - Intergenic
1110148507 13:72222495-72222517 TTCCCTGGACATAACAGCATAGG - Intergenic
1112299110 13:98214026-98214048 GGCCCTGGACAGAGCAGCCTGGG + Intronic
1112860205 13:103820715-103820737 AGCCCAGGAGAAACCAGCCTGGG - Intergenic
1113551989 13:111199812-111199834 TGCCCAGGAACAATCAGCCTGGG + Intronic
1122919088 14:104872645-104872667 TGCCCCAGAGACCACAGCCTGGG + Intronic
1122999423 14:105284482-105284504 GGCCCAGGAGAAAACAGCCAGGG + Intronic
1128998142 15:72311932-72311954 TGCCCTGCACAAAACAGCTTGGG - Intronic
1129504598 15:76071002-76071024 TCCCCGGGACAAACCAGACTGGG - Intronic
1130093675 15:80840715-80840737 TGCCCTGGACACACCAGCCTGGG + Intronic
1130689305 15:86066714-86066736 GGCCACGGATAAAACAGCCTGGG + Intergenic
1133598995 16:7320901-7320923 TGCCCAGGGAAAAACAGCCAGGG + Intronic
1138333174 16:56231490-56231512 TGCTAGGGACAAAACAGACTCGG - Intronic
1138747928 16:59385278-59385300 TGCCAGGGAAAAAACATCCTTGG - Intergenic
1139509889 16:67421453-67421475 TGCCCAGGATAGAACAGCCAAGG + Intergenic
1141454053 16:84126802-84126824 TGCCATGGACAAAACAGCAAAGG + Intronic
1142661919 17:1436628-1436650 TGCCTACGACAAGACAGCCTTGG - Exonic
1143164399 17:4890705-4890727 TCCCGCTGACAAACCAGCCTGGG + Exonic
1148722287 17:49763034-49763056 TGCCCCGGACAAAACAGCCTTGG + Intronic
1152717313 17:81906292-81906314 TGCCCCAGACAGGACAGCCCTGG + Intronic
1161407547 19:4098987-4099009 TGCCCCGGACAGAACAGGTTTGG + Intronic
1161800114 19:6412735-6412757 TGCCCAGGTCCAAACAGCTTGGG + Intergenic
1166481564 19:43178721-43178743 TGCCCCAGGCAAAACAGAGTAGG - Intronic
925744062 2:7029891-7029913 AGCCCTGGACAGCACAGCCTCGG - Intronic
926787383 2:16531498-16531520 TACCCAGGACAAATCAGCATGGG + Intergenic
931245787 2:60491743-60491765 TGCCCACGTCAAAACACCCTAGG + Intronic
931756581 2:65379973-65379995 TGCCACGGACAGAGCAGCCAGGG - Intronic
932692241 2:73922868-73922890 TGCCCAGGACAAAATCGCCCAGG + Intergenic
932716595 2:74104787-74104809 TCCCCCAGCCCAAACAGCCTTGG + Exonic
937097359 2:119244048-119244070 TGCACCAGACAAAATAGCTTAGG + Intronic
946190071 2:218003304-218003326 CGCCCCTGGCAAACCAGCCTGGG + Intergenic
1171464289 20:25316996-25317018 TGCCCTGGAAAGAACAGCCCAGG + Intronic
1172918816 20:38462928-38462950 TGCCCCAAACAAAACAGGCTGGG - Intergenic
1175200786 20:57276088-57276110 TGCCCCAGACAACTGAGCCTCGG + Intergenic
1175704848 20:61169077-61169099 TGCCCCTGACCAAAGAGCATCGG + Intergenic
1180754663 22:18152629-18152651 TCCACCAGAGAAAACAGCCTGGG - Intronic
1181893855 22:26088906-26088928 TGCCCTGGGCTACACAGCCTGGG + Intergenic
1184672598 22:46023224-46023246 AGCACAGGTCAAAACAGCCTGGG + Intergenic
953440590 3:42913284-42913306 TTACCCGGACAAATCAGGCTTGG - Intronic
959349441 3:105242611-105242633 TTCCCTGGAAAAAACAACCTAGG - Intergenic
961106700 3:124248793-124248815 AGCTCCGGACAGAACAGTCTGGG - Intronic
962135400 3:132726356-132726378 TGAGCAGGACTAAACAGCCTGGG - Intergenic
968705379 4:2075147-2075169 GGCCTCAGACAAAGCAGCCTTGG + Intronic
974973848 4:68865730-68865752 TGCACCACACAAAAAAGCCTAGG + Intergenic
982459618 4:155652474-155652496 TGTCTATGACAAAACAGCCTGGG + Intergenic
983671839 4:170246734-170246756 TTCCCCGCAAAAAACAGCCCTGG + Intergenic
984956864 4:185053704-185053726 AGACCAGGAAAAAACAGCCTCGG + Intergenic
988434821 5:31161861-31161883 TGCTCCAGACAAATTAGCCTAGG - Intergenic
993539853 5:89135359-89135381 TGCCTCAGAGAAAACAGCCCAGG - Intergenic
997021074 5:130002329-130002351 TGCCTGGCACAAATCAGCCTGGG - Intronic
1001554342 5:172625826-172625848 TCCCCAGGAGAAAACAGCCAGGG - Intergenic
1001855596 5:175007806-175007828 TGCCCTGCACCAAACAGCCTTGG + Intergenic
1014807350 6:125845146-125845168 CGACCAGGAAAAAACAGCCTAGG + Intronic
1017916398 6:158835155-158835177 TGACCTGGACCCAACAGCCTTGG + Intergenic
1018829026 6:167428073-167428095 TGCTCAGGACAGCACAGCCTCGG - Intergenic
1019990381 7:4686272-4686294 GGCCCCGGACAACACAGCTTTGG - Intronic
1025141450 7:56470172-56470194 TGCACAGGGCAAGACAGCCTAGG + Intergenic
1037248865 8:16869065-16869087 TTCCCCCCACAAAATAGCCTTGG - Intergenic
1038503379 8:28063618-28063640 TGTCCAGGACCACACAGCCTTGG - Intronic
1040985866 8:53293949-53293971 TGGCTAGGACAATACAGCCTAGG + Intergenic
1043362625 8:79492964-79492986 TTCCCCACACAAAAGAGCCTTGG - Intergenic
1048885871 8:138909423-138909445 TGCCCCTGACAACTCAGCCACGG + Intronic
1049826215 8:144670494-144670516 TGCTCCGGACATAAAAGCCTGGG + Intergenic
1051003314 9:12312147-12312169 AGCCCAGGACAAGACAGCCCAGG - Intergenic
1056670194 9:88620970-88620992 TGCCCTGGAAAATACAGACTAGG - Intergenic
1060196118 9:121624398-121624420 TGCCACTTACAAACCAGCCTTGG + Intronic
1193472190 X:81920044-81920066 AGCTCCTGACATAACAGCCTTGG + Intergenic
1196552760 X:117048961-117048983 TGGCCAGTACAAAAAAGCCTGGG + Intergenic
1197735561 X:129848257-129848279 AGCCCCCCAAAAAACAGCCTGGG + Intergenic