ID: 1148722290

View in Genome Browser
Species Human (GRCh38)
Location 17:49763037-49763059
Sequence CCCGGACAAAACAGCCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722284_1148722290 1 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722278_1148722290 27 Left 1148722278 17:49762987-49763009 CCATGCACTTGACTGTAGCCCTC 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722283_1148722290 2 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722285_1148722290 -5 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722281_1148722290 8 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722282_1148722290 3 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722279_1148722290 9 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101
1148722277_1148722290 30 Left 1148722277 17:49762984-49763006 CCACCATGCACTTGACTGTAGCC 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722290 Original CRISPR CCCGGACAAAACAGCCTTGG TGG Intronic
900380666 1:2382302-2382324 CCAGGGCAACACAGCCCTGGGGG - Intronic
901716237 1:11156909-11156931 CTAGGACAGGACAGCCTTGGGGG - Intronic
904877615 1:33668566-33668588 CCAGGCCAAAACAGCCATTGTGG + Intronic
905215580 1:36405112-36405134 CCCGGACTCAACAGCATGGGAGG - Intergenic
906300034 1:44674881-44674903 ACCGTACAAAACGGCCTAGGGGG + Intronic
910324326 1:85987608-85987630 CCTGGACAAAACGGCCCTGAAGG - Exonic
917086203 1:171307809-171307831 CTCAGACAAACCAACCTTGGTGG + Intergenic
917795015 1:178527095-178527117 CCTGGACTAAACATCCCTGGAGG + Intronic
918140050 1:181712639-181712661 TCCCTACACAACAGCCTTGGAGG - Intronic
922674277 1:227541457-227541479 CCAGGAAAACACAGCTTTGGAGG - Intergenic
1063414877 10:5865128-5865150 CTCAGACAAACCAACCTTGGTGG + Intronic
1065948507 10:30628543-30628565 CCCAAACACAACAGCCTTGCTGG + Intronic
1068108593 10:52651702-52651724 CCCGGACAAAACACTCTTAAGGG - Intergenic
1072185902 10:93038675-93038697 CTGGGACAAAACAGCCATGAAGG - Intronic
1073806830 10:107107635-107107657 CACAGACAAAATAGCCTTTGTGG + Intronic
1074022648 10:109599866-109599888 CCCAAACAAACCAGCATTGGGGG + Intergenic
1075796522 10:125123884-125123906 CCCTGACAGAGCAGCCCTGGAGG + Intronic
1075849812 10:125577640-125577662 CCTGGAGAAAAAAGACTTGGAGG - Intronic
1076007461 10:126959300-126959322 CCCCCACAAAACAGCTTTGCAGG + Intronic
1076344377 10:129770445-129770467 CAAGGACAGAACAGCCCTGGGGG + Intergenic
1078441594 11:11372799-11372821 CCCGGATGAAACAGCCTTTCTGG - Intronic
1090044032 11:123315369-123315391 CCGGGACAGGAAAGCCTTGGAGG - Intergenic
1091177980 11:133579186-133579208 CAGAGGCAAAACAGCCTTGGAGG + Intergenic
1091309070 11:134560180-134560202 CTCTGACACATCAGCCTTGGGGG - Intergenic
1096863633 12:54548478-54548500 CCAGCACAAAACAGCCTAGCTGG - Intergenic
1105339558 13:19507540-19507562 CCTGAACAAAGCAGCATTGGAGG - Intronic
1108108399 13:47039254-47039276 CCTGAATAAAACAGCCTTGAGGG + Intergenic
1113117039 13:106885124-106885146 CCCGGAGCAGACAGCCATGGGGG + Intergenic
1116681973 14:47983841-47983863 CATGGACAAAAGAGCCTTTGTGG + Intergenic
1117047519 14:51828183-51828205 CCAGCACAAAGCAGCCTTGCCGG - Intronic
1117815175 14:59590428-59590450 CCCAGCCAAAACTGCCTTCGTGG + Intergenic
1121333661 14:93063603-93063625 CCAGGACTGCACAGCCTTGGAGG + Intronic
1127256197 15:57296017-57296039 GCAGGGCAAAACAGCCTGGGAGG - Intronic
1129358679 15:75010846-75010868 CCCGGGCAAAACAGCCTTCTAGG - Intronic
1130568803 15:85022393-85022415 CCCAGACAAAGCTGCCTGGGTGG - Intronic
1130689307 15:86066717-86066739 CACGGATAAAACAGCCTGGGTGG + Intergenic
1135103983 16:19631371-19631393 CCCTGTCACAACAGCCTTTGAGG + Intronic
1135541240 16:23331923-23331945 CCCACACAAAACAGCCCTGTGGG - Intronic
1137410290 16:48222527-48222549 TCCGGACATAACTGCCCTGGGGG - Intronic
1140528878 16:75647485-75647507 CCCCGGCACAGCAGCCTTGGTGG + Intronic
1141538316 16:84699328-84699350 CACGGGCAAACCAGCCTTGGGGG - Intergenic
1148216172 17:45835076-45835098 CTGGGAGAAGACAGCCTTGGAGG - Exonic
1148722290 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG + Intronic
1149542771 17:57480261-57480283 TCCTGACAAAAGAGCCTTCGTGG - Intronic
1152752130 17:82067483-82067505 CACAGATAGAACAGCCTTGGTGG + Intergenic
1152897478 17:82921049-82921071 CCGGGACACCACAGCCCTGGGGG - Intronic
1161481541 19:4513261-4513283 GCCGGTCAGCACAGCCTTGGAGG + Exonic
1164680074 19:30128359-30128381 CCTGGACTTCACAGCCTTGGTGG - Intergenic
1165978593 19:39699689-39699711 CCCAGAGGAAACAGCTTTGGTGG - Intergenic
926023500 2:9518117-9518139 CCCAGAGCAAACAGCCATGGAGG - Exonic
928242657 2:29600148-29600170 CCCAGGAAAAACAGTCTTGGGGG - Intronic
933342227 2:81038192-81038214 CTCAGACAAAAAAACCTTGGTGG + Intergenic
934955794 2:98617328-98617350 CCCTGACAAACCAGCCAAGGGGG - Intronic
937879901 2:126857308-126857330 CCCGGAAAAAAGAGGCTTGTGGG + Intergenic
938100325 2:128493629-128493651 CCCGGACCCAGCAGCCTGGGAGG + Intergenic
1170995736 20:21356079-21356101 GCCAGAAGAAACAGCCTTGGAGG + Exonic
1176734630 21:10534205-10534227 CCTGAACAAAGCAGCATTGGAGG + Intronic
1177439154 21:21097663-21097685 CTTGCACAAAACAGCCTTGGTGG - Intronic
1179731036 21:43367622-43367644 CCCGTGCAAAACAGCCTGAGGGG + Intergenic
1180562365 22:16629679-16629701 CCTGAACAAAGCAGCATTGGAGG + Intergenic
1180754661 22:18152626-18152648 ACCAGAGAAAACAGCCTGGGCGG - Intronic
1181438758 22:22924998-22925020 CCAGGCCAAATCACCCTTGGAGG + Intergenic
1183648096 22:39138418-39138440 CCCGGGGAAGACAGCCTGGGTGG - Intronic
950259889 3:11536100-11536122 CCCTGAGAAAACAGCCTGGCTGG - Intronic
954232199 3:49226145-49226167 CTCAGACAAACCAACCTTGGTGG - Intronic
961093142 3:124132723-124132745 CCCTGCCAAAACAGCCATGAAGG - Intronic
963019451 3:140858698-140858720 CGTGGAGAAAACAGCCTTGCAGG + Intergenic
967225914 3:187291289-187291311 CACGGAAAAATCAGCCTTGTGGG + Intronic
967920328 3:194609547-194609569 CCTCGACAAGACAGTCTTGGTGG + Intronic
968408159 4:360160-360182 CCCTGACAAAACAACCTTTACGG - Intronic
969653336 4:8480926-8480948 CCCACACAAAACAGCTTTGTAGG - Intronic
975595768 4:76047240-76047262 CTCAGACAAACAAGCCTTGGTGG - Intronic
979105185 4:116676691-116676713 CCTGGACAAAACAGACTTCCCGG - Intergenic
982877356 4:160665297-160665319 CTCAGACAAAAAAACCTTGGTGG + Intergenic
986430192 5:7673825-7673847 CCAGGATACAACAGCCCTGGAGG - Intronic
989147860 5:38266191-38266213 CCAGGAGAAACCAGCCTTGAAGG - Intronic
994231677 5:97315328-97315350 CTCAGACAAACCAACCTTGGTGG - Intergenic
996778633 5:127159876-127159898 CCTGGACAAAATAGCCATGCTGG + Intergenic
997582521 5:135026770-135026792 CCAGGTCAACACAGCCTTTGAGG - Intergenic
1001032741 5:168274811-168274833 CATGGACAAAAAAGCATTGGGGG + Intergenic
1001147996 5:169201712-169201734 CCCTGGCACAGCAGCCTTGGAGG - Intronic
1002051923 5:176576176-176576198 CCCGGACAAGGCAGGCGTGGTGG + Exonic
1003334832 6:5160546-5160568 CCTTTAAAAAACAGCCTTGGTGG - Intronic
1005115211 6:22328548-22328570 CGTGGCCAAAACAGTCTTGGGGG - Intergenic
1007030092 6:38619364-38619386 CTCAGACAAACAAGCCTTGGTGG + Intronic
1019799515 7:3077865-3077887 CCCGGACCTCACAGCCTTGCCGG + Intergenic
1023216236 7:37866060-37866082 CCCAGACAAAAAAGAGTTGGTGG - Intronic
1030661477 7:112223672-112223694 CCTGGACAAAAGCGCCTTTGTGG - Intronic
1035733135 8:1866577-1866599 CCCGGCCAACACAGCCTGGATGG + Exonic
1040285959 8:46100534-46100556 CCTGGCCAGAACACCCTTGGGGG + Intergenic
1040299302 8:46179733-46179755 CCCGCACGGAACAGCCCTGGGGG + Intergenic
1041113170 8:54506735-54506757 CCCGGAAAGAACAGGCATGGAGG - Intergenic
1045313773 8:101026245-101026267 GCCTAACAAAACAGCCATGGGGG - Intergenic
1052633379 9:31070104-31070126 CCCAGACAAAACATCATTTGTGG + Intergenic
1053680555 9:40482837-40482859 CTGGGAGAAAAAAGCCTTGGAGG - Intergenic
1053821889 9:41976107-41976129 CCTGGAGAAAACAGGCTTGATGG - Intronic
1054283157 9:63142098-63142120 CTGGGAGAAAAAAGCCTTGGAGG + Intergenic
1054391661 9:64622841-64622863 CTGGGAGAAAAAAGCCTTGGAGG - Intergenic
1054504066 9:65893487-65893509 CTGGGAGAAAAAAGCCTTGGAGG + Intronic
1054608683 9:67211301-67211323 CCTGGAGAAAACAGGCTTGATGG + Intergenic
1055513451 9:77016401-77016423 CTGGGACAAAACAGTCTCGGAGG - Intergenic
1188919988 X:35961430-35961452 CCAGGACAAAATGGCTTTGGTGG - Intronic
1189818399 X:44846570-44846592 CCCCGACAAAGCAGCCTTTCTGG + Intergenic
1196419341 X:115506684-115506706 CTCGGACAAACAAACCTTGGTGG - Intergenic
1199716207 X:150508816-150508838 CCCAGACAGAGCTGCCTTGGTGG + Intronic
1201455160 Y:14161184-14161206 CTCGGACAAACAAACCTTGGGGG + Intergenic