ID: 1148722292

View in Genome Browser
Species Human (GRCh38)
Location 17:49763038-49763060
Sequence CCGGACAAAACAGCCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722283_1148722292 3 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722278_1148722292 28 Left 1148722278 17:49762987-49763009 CCATGCACTTGACTGTAGCCCTC 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722281_1148722292 9 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722279_1148722292 10 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722284_1148722292 2 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722285_1148722292 -4 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1148722282_1148722292 4 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722292 Original CRISPR CCGGACAAAACAGCCTTGGT GGG Intronic
900655634 1:3755462-3755484 CCGGACAAATCGGCCTCAGTGGG - Exonic
905926972 1:41758156-41758178 CCGGGGAAGGCAGCCTTGGTTGG - Intronic
917593699 1:176505233-176505255 GAGGACAAAATAGCCTTGGAAGG - Intronic
918127528 1:181597435-181597457 CAGGACAAAACACACTTCGTTGG + Intronic
918400296 1:184156257-184156279 GGGGACAAGACAGCCTTTGTGGG - Intergenic
1065948509 10:30628544-30628566 CCAAACACAACAGCCTTGCTGGG + Intronic
1069146389 10:64896740-64896762 CTGGTCTTAACAGCCTTGGTGGG - Intergenic
1073007568 10:100336471-100336493 CCAGACAAAAGAATCTTGGTTGG + Intergenic
1073806831 10:107107636-107107658 ACAGACAAAATAGCCTTTGTGGG + Intronic
1078108013 11:8370776-8370798 CCTGACAAGAGAGCCTAGGTTGG - Intergenic
1111820200 13:93204588-93204610 TGGAAAAAAACAGCCTTGGTGGG + Intergenic
1114752438 14:25219999-25220021 CAGGAGAAAGCAGCCCTGGTTGG + Intergenic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1127869560 15:63059939-63059961 CCGGACAAAAGATCTTTGGCCGG + Intronic
1128236223 15:66069202-66069224 CAGGACCAAACAGACTTGGACGG - Intronic
1129708097 15:77806070-77806092 CCGGAGAAATCAGTCCTGGTTGG + Intronic
1130689308 15:86066718-86066740 ACGGATAAAACAGCCTGGGTGGG + Intergenic
1137685457 16:50383638-50383660 CCAGGCAAAACAGCCTTCCTTGG - Intergenic
1138510949 16:57508172-57508194 CTGGACAAAATGGCCTTGGCTGG + Intergenic
1140528880 16:75647486-75647508 CCCGGCACAGCAGCCTTGGTGGG + Intronic
1142422864 16:89983316-89983338 CCAGACAAAAAGGCCTTGGGTGG - Intergenic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1149083280 17:52683893-52683915 CTGTACAATAAAGCCTTGGTAGG + Intergenic
1150868866 17:68882177-68882199 CCTGAAAAAACTGCCTTTGTAGG - Intronic
1151686639 17:75651048-75651070 CCCGACACAACAGCCTTTGCAGG + Intronic
930722977 2:54655679-54655701 CACGACAAAACAGCTTTGGCAGG + Intronic
942486449 2:176444896-176444918 CAGGAGAAAACAGCTGTGGTAGG + Intergenic
944908886 2:204289935-204289957 CTGGACAAAACATTCTTGTTTGG - Intergenic
1173068463 20:39737285-39737307 CCTGAAAAAACAGCCTTGCATGG - Intergenic
1178318414 21:31586220-31586242 CTGAACAAAACAGCAGTGGTCGG + Intergenic
1180589577 22:16925417-16925439 CTGGACATAACATCCTGGGTTGG - Intergenic
1183648094 22:39138417-39138439 CCGGGGAAGACAGCCTGGGTGGG - Intronic
1185086556 22:48744047-48744069 CTCGACAGAACAGCCTTGGCAGG - Intronic
950259887 3:11536099-11536121 CCTGAGAAAACAGCCTGGCTGGG - Intronic
981028723 4:140102418-140102440 CAGGAGAAACCAGCCTTGCTTGG - Intronic
993770106 5:91916244-91916266 CTGGCTAAAACAGCCTGGGTTGG + Intergenic
996697945 5:126419689-126419711 CCAGACATAACACCTTTGGTGGG - Intronic
996778634 5:127159877-127159899 CTGGACAAAATAGCCATGCTGGG + Intergenic
998956288 5:147441788-147441810 TGGGAAAAAACAGCCTTGCTTGG - Intronic
1008293047 6:49741298-49741320 CAGGAAAAAACAGCATTGGGAGG - Intronic
1010255404 6:73751454-73751476 CTGATCAAAACAGCCTTAGTAGG - Intronic
1012845570 6:104383269-104383291 CAGGACAAAAAATTCTTGGTTGG - Intergenic
1014505964 6:122256696-122256718 CGGGACAAAACACACTTTGTTGG - Intergenic
1015217315 6:130765268-130765290 CTGGAGAAAACAGCCTTATTTGG + Intergenic
1022922261 7:35027385-35027407 CCGAACTACAAAGCCTTGGTAGG + Intronic
1023216234 7:37866059-37866081 CCAGACAAAAAAGAGTTGGTGGG - Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031336118 7:120534596-120534618 ACTGAAAAAACACCCTTGGTGGG - Intronic
1032744001 7:134767609-134767631 CCTCACCAAACAGTCTTGGTTGG + Intronic
1034004105 7:147450018-147450040 CAGGACAGGACACCCTTGGTTGG - Intronic
1035520373 8:271321-271343 CGGGAGGAAACAGCCTTGGTAGG - Intergenic
1039805646 8:40995192-40995214 CCTGACATAACACCCCTGGTAGG + Intergenic
1039983562 8:42429010-42429032 CAGGAAAATGCAGCCTTGGTGGG - Intronic
1047036189 8:120941042-120941064 ACTGACAATGCAGCCTTGGTTGG + Intergenic
1047225427 8:122952369-122952391 CAGGACAACTCAGCCTGGGTCGG - Exonic
1057016549 9:91657531-91657553 CAGGACCAAACAGCCTGAGTTGG - Intronic
1059312060 9:113395341-113395363 CTGGACAAGACAGCCTCAGTGGG - Intronic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1185845191 X:3431162-3431184 CCAAAGAAAACAGCCTTGGTAGG + Intergenic
1195107838 X:101617513-101617535 AAGGAGAAAACTGCCTTGGTTGG - Exonic