ID: 1148722295

View in Genome Browser
Species Human (GRCh38)
Location 17:49763046-49763068
Sequence AACAGCCTTGGTGGGTAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 228}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722285_1148722295 4 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 228
1148722284_1148722295 10 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 228
1148722283_1148722295 11 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 228
1148722282_1148722295 12 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 228
1148722279_1148722295 18 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 228
1148722281_1148722295 17 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722295 Original CRISPR AACAGCCTTGGTGGGTAGAG GGG Intronic
900360874 1:2288407-2288429 AACAGCCCTGCTGGGCACAGTGG - Intronic
901161050 1:7177056-7177078 AGGAGCCTTGGTGGGTAGGAGGG - Intronic
902676946 1:18015408-18015430 CACAGCCTTGGCAGATAGAGAGG + Intergenic
903174962 1:21575299-21575321 AACAGCAATGCTGGGCAGAGAGG - Intronic
903797751 1:25942738-25942760 AACAGACTTGGTGGAGAGAAGGG + Intergenic
904565460 1:31425759-31425781 ACCAGACTGGGTGGGGAGAGGGG - Exonic
904599492 1:31665730-31665752 GCCAGCCATGGTGGGCAGAGGGG - Intronic
904735576 1:32630036-32630058 AACAGGCTTGCTGGGTGCAGTGG - Intronic
904929437 1:34074689-34074711 TACAGCCTTGTGGGGTAGATGGG + Intronic
905230405 1:36511650-36511672 AACGGACTTGGGGGGAAGAGTGG + Intergenic
905246560 1:36618607-36618629 ACCAGCTTTGGTGAGTAGATTGG + Intergenic
906997729 1:50815568-50815590 AATAGCATTGCTGGGTAGAACGG + Intronic
911265181 1:95734585-95734607 AACAGGCCTGGTGGGAAAAGAGG + Intergenic
912189531 1:107321785-107321807 AACAGGATTGGCTGGTAGAGAGG - Intronic
913283650 1:117208672-117208694 AACAGCCATGATGGGGAGAGGGG + Intronic
913460741 1:119083373-119083395 ACCAGCCTTGGTGTGTGGTGAGG - Intronic
914675241 1:149903249-149903271 AACAGCCTTGGAGGGTAAAATGG - Intergenic
916519404 1:165550295-165550317 AGCAGACTTTGCGGGTAGAGGGG - Intronic
916641594 1:166734555-166734577 AACGGCATTGGTGGTTTGAGAGG - Intergenic
918423963 1:184389308-184389330 AATGGCCTTGGGTGGTAGAGAGG + Intronic
920053877 1:203179264-203179286 CTCAGCCCTGGTGGGCAGAGAGG - Exonic
920327861 1:205180750-205180772 AACAGCCTGGCTGGGCACAGTGG - Intronic
921343053 1:214153763-214153785 CACTGCCTTGGGGGGTAGAGGGG - Intergenic
922900996 1:229136599-229136621 AACAGCCTTGGCTGGCTGAGGGG - Intergenic
923473983 1:234315984-234316006 GGGAGCCTTGGTGGGTAGGGTGG + Intronic
923514685 1:234685049-234685071 AACAGCCTGGGTGGGGAAAGGGG + Intergenic
1062821021 10:534616-534638 GACAGCCTGGGAGGGTAGATGGG - Intronic
1062844381 10:692566-692588 GACAGCCGTGGTGGGAAGACTGG - Intergenic
1064479464 10:15725148-15725170 CACAGCCCTTGTGGGTGGAGAGG + Intergenic
1068194724 10:53701279-53701301 AAGAGCCTTAGAGGGTAAAGTGG - Intergenic
1069216974 10:65833157-65833179 AAAGGTCTTGGTGGGTAGGGGGG - Intergenic
1069903963 10:71721448-71721470 ACCAGCCTTGCAGGGTTGAGGGG - Intronic
1070122650 10:73593731-73593753 AAAATCCTTGGAGGGTAGTGGGG + Intronic
1071830620 10:89368492-89368514 AGCAGAGTTGGTGGGTGGAGAGG - Intronic
1071881057 10:89898500-89898522 AACTACCAGGGTGGGTAGAGGGG + Intergenic
1072030193 10:91512063-91512085 CACAGCCTTAGTGTCTAGAGTGG + Intronic
1074845342 10:117392585-117392607 AACAGCCTAGAAGGGAAGAGGGG - Intergenic
1075007355 10:118840547-118840569 AACAGCCTTGGTGGGTAGCTTGG + Intergenic
1076413998 10:130271894-130271916 GACAGCTTTGGAGGGCAGAGGGG - Intergenic
1076780945 10:132724240-132724262 TACAGACTTGGTGGGAAGATGGG + Intronic
1076813155 10:132899458-132899480 CACAGCCTTGGTGAGCACAGGGG + Intronic
1076948458 10:133666640-133666662 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
1076949447 10:133669950-133669972 ACCAGCCTGGGAGGGTGGAGGGG - Intronic
1076950431 10:133673249-133673271 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
1076951416 10:133676548-133676570 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
1076952406 10:133679858-133679880 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
1076953394 10:133683168-133683190 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
1076955362 10:133742819-133742841 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
1076956352 10:133746129-133746151 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
1076957340 10:133749438-133749460 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
1076958329 10:133752748-133752770 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
1076959313 10:133756047-133756069 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
1076960302 10:133759357-133759379 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
1077297317 11:1832288-1832310 AGCCGCCTTCGTGGGGAGAGAGG + Intronic
1084264121 11:67996151-67996173 AAGAGCCAGGGTGGGGAGAGGGG + Intronic
1085299959 11:75452052-75452074 GATAGCCATGGTGGGTACAGGGG + Intronic
1085869552 11:80333203-80333225 AACACCCTTGTTAGGAAGAGTGG + Intergenic
1087847765 11:102992783-102992805 AAAAGCATGGATGGGTAGAGGGG + Intergenic
1088645437 11:111913174-111913196 AACGGCCTGGGTGGATAGAAGGG - Intronic
1088717861 11:112564701-112564723 AACAGCCTTTGTGGCCACAGTGG - Intergenic
1090003380 11:122980517-122980539 AACAACCATGGTCGGTGGAGGGG - Intronic
1091055788 11:132417531-132417553 GCCAGCCTTGTTGGGTTGAGAGG + Exonic
1091698146 12:2641816-2641838 AACAGCCTTTGTGGGGGGATGGG - Intronic
1092537755 12:9403970-9403992 AAGAGCCACGGGGGGTAGAGGGG - Intergenic
1092538416 12:9405850-9405872 AAGAGCCTGGGGGGGAAGAGGGG - Intergenic
1092556957 12:9569475-9569497 AAGAGCCAGGGGGGGTAGAGCGG + Intergenic
1094514155 12:31118122-31118144 AAGAGCCTGGGGGGGAAGAGAGG - Intergenic
1094514208 12:31118281-31118303 AAGAGCCTGGGGGGGAAGAGGGG - Intergenic
1094514531 12:31119362-31119384 AAGAGCCACGGGGGGTAGAGGGG - Intergenic
1094515042 12:31121001-31121023 AAGAGCCTGGGGGGGAAGAGGGG - Intergenic
1095307075 12:40651270-40651292 CACAGCCTGGGTGGGTTGAGTGG - Intergenic
1096836918 12:54357023-54357045 TACAGCCTTGGTTTGGAGAGGGG + Intergenic
1097418269 12:59341155-59341177 ATCAGTTTTGGTGGGGAGAGGGG - Intergenic
1098193791 12:67978169-67978191 AAGAGCCTTGGACTGTAGAGAGG - Intergenic
1098236996 12:68426948-68426970 AACAGCTATGGTGGGGAGTGGGG + Intergenic
1100120808 12:91367364-91367386 AAAAGCATGGGTGGGTATAGAGG - Intergenic
1100596996 12:96080344-96080366 GACAGCCTTGCTGGGCACAGTGG + Intergenic
1108454383 13:50598255-50598277 GAAAGCCTGTGTGGGTAGAGAGG - Intronic
1108829351 13:54457648-54457670 AACTGCTGTGGTGGGTATAGGGG + Intergenic
1109357328 13:61247581-61247603 AAGAGCCTTGTTGGGCAGGGAGG + Intergenic
1110892284 13:80707208-80707230 AACAGCCTGGGGGGGAAGAGGGG - Intergenic
1114427097 14:22632953-22632975 AATAGGCTTGGTGGCTGGAGTGG - Intergenic
1117699647 14:58400116-58400138 ACCAGCTTTGCTGGGTACAGTGG + Intronic
1119821403 14:77619346-77619368 AACAAGCTTGGTGAGTTGAGGGG + Intergenic
1122757100 14:103990203-103990225 CACAGCCTTGGTTTGTAGATGGG - Intronic
1202856885 14_GL000225v1_random:57644-57666 AACGGCCTGGGAGGGTGGAGGGG - Intergenic
1124159541 15:27255940-27255962 AACATCTTTGGTGGAGAGAGAGG - Intronic
1124954065 15:34348374-34348396 AACAGCCTTAGAGGGCAGAATGG - Exonic
1125641354 15:41233008-41233030 GACTGCCTTGGTAGGTGGAGAGG - Intronic
1128152655 15:65372915-65372937 CACAGCCTTGCAGGGGAGAGAGG + Intronic
1131842275 15:96450186-96450208 GACAGCATTCGTGGATAGAGTGG - Intergenic
1135731719 16:24900215-24900237 AACATCCTTGGTGAGTACACTGG - Intronic
1137310435 16:47251444-47251466 ATCAGTGTTGGTGGGTAGTGCGG - Intronic
1137562010 16:49508811-49508833 TACAGCGTTGGTGGGAAGCGTGG - Intronic
1137854547 16:51780763-51780785 AACAGCCTTTGAGAGTAGGGTGG - Intergenic
1140510301 16:75502679-75502701 ACCAGCCTGGGTGGGCAGAAGGG - Intergenic
1140516067 16:75542745-75542767 ACCAGCCTGGGTGGGCAGAAGGG - Intronic
1147898622 17:43769144-43769166 CACAGACGTGGTGGGGAGAGTGG + Exonic
1148722295 17:49763046-49763068 AACAGCCTTGGTGGGTAGAGGGG + Intronic
1150924226 17:69515717-69515739 GACAGCCTGGTTGAGTAGAGAGG + Intronic
1151185902 17:72363667-72363689 AACAGCCAAGGTGGGTGGGGTGG + Intergenic
1153880099 18:9414866-9414888 CACAGCCTCTGTGGGGAGAGGGG + Intergenic
1154324770 18:13381964-13381986 AACTTCTCTGGTGGGTAGAGTGG + Intronic
1155128956 18:22910863-22910885 AATAGCCTTGGGGAGTAGAGTGG - Intronic
1156206667 18:34893738-34893760 AACAGATTTTGTGGGTAGATTGG + Intergenic
1156460454 18:37318808-37318830 CACGGCCTTGCTGGGCAGAGGGG + Intronic
1157408094 18:47440674-47440696 AAGAGCCTTGAAGGGCAGAGTGG + Intergenic
1157801079 18:50621986-50622008 TACAGCCTTTCTGGGTAGACAGG + Intronic
1160225015 18:77005722-77005744 TACAGCCTTGAGGGGCAGAGGGG + Intronic
1161350766 19:3790257-3790279 ACCAGCCTGAGTGGGTAGACTGG + Intronic
1162903072 19:13806877-13806899 AACATCGTGGGTGGGCAGAGTGG + Intronic
1166110835 19:40622140-40622162 AACAGCTTGGGTGGGTGGTGAGG - Intronic
1167603523 19:50467824-50467846 AACAGCCTGGGTGGGAGGAAGGG + Exonic
926348750 2:11975599-11975621 CAGAGCCTGTGTGGGTAGAGGGG + Intergenic
927933737 2:27062804-27062826 AACAGAGCTGGTGGGTGGAGAGG + Intronic
929571221 2:43024328-43024350 AACAGCCCTGGGGGGGTGAGGGG + Intergenic
931189447 2:59985838-59985860 AACAGCATTGGGGGAAAGAGTGG + Intergenic
932197649 2:69798110-69798132 AACAGCCTAAGTGGACAGAGGGG + Intronic
932748030 2:74350805-74350827 AACATCCTTGGAGGATGGAGGGG - Intronic
936403750 2:112184866-112184888 AACAGCCATGGAGGGTAATGGGG + Intronic
937490926 2:122366441-122366463 AACAGCTAAGGTGGGTAGGGGGG + Intergenic
937593217 2:123640295-123640317 TACAGCCTTGCAGGGTAGATAGG - Intergenic
938704185 2:133906693-133906715 AAAAGAGTTGGTGGGTAAAGTGG - Intergenic
941708041 2:168680556-168680578 AGCAGCCTTGGAGGGTGGGGTGG - Intronic
944918909 2:204390134-204390156 AACAGCCTTTGTGTGTACAGAGG + Intergenic
945054601 2:205857489-205857511 AACACCCTTGGTCTTTAGAGAGG + Intergenic
945936790 2:215910628-215910650 AAGAACCATGGAGGGTAGAGAGG - Intergenic
947703242 2:232253285-232253307 AAAAGCCCTCGTGGGTAAAGTGG - Intronic
1170166536 20:13365604-13365626 AACAAACTTGGTGTGTTGAGGGG + Intergenic
1174129584 20:48333350-48333372 AACAGCTTTGCTGGGCATAGTGG - Intergenic
1174911992 20:54617610-54617632 AACAGACTGGCTGGGTACAGTGG - Intronic
1175080050 20:56411850-56411872 AACTGACAGGGTGGGTAGAGTGG + Intergenic
1175421631 20:58838434-58838456 AACAATGTTGGTGGGTACAGAGG + Intergenic
1175793049 20:61754384-61754406 AACAGCCCTGGAGGGAAGAGTGG - Intronic
1176386736 21:6141727-6141749 AAGAGCTTTGGTGGGAGGAGCGG + Intergenic
1177781064 21:25622736-25622758 AACAGCCTCGGTGGGGATGGTGG + Intergenic
1178180284 21:30152483-30152505 ATCAGCCTTGCTGAGAAGAGTGG + Intergenic
1178273256 21:31213014-31213036 AACAGCATGTGTGGGCAGAGAGG + Intronic
1179736737 21:43396525-43396547 AAGAGCTTTGGTGGGAGGAGCGG - Intergenic
1180254312 21:46613448-46613470 AACAGGATTGCTGGGTTGAGTGG + Intergenic
1181515090 22:23405592-23405614 AACAGCCCTGCTGGGGACAGAGG - Intergenic
1182425275 22:30268252-30268274 AACTGCCTTGGTGGCCACAGTGG - Intergenic
1182941594 22:34282243-34282265 AAGAGATTTGGTGGGGAGAGCGG - Intergenic
1183489397 22:38108593-38108615 ATCAGCACTGGTGGGTAGTGGGG + Intronic
1183515894 22:38265906-38265928 AACAGCCCTGCTGAGTGGAGTGG + Intronic
1184672602 22:46023236-46023258 AACAGCCTGGGTGTGGAGGGAGG + Intergenic
1185047209 22:48534500-48534522 GACAGCCTGGGTGGGTGGACAGG + Intronic
949883474 3:8678530-8678552 AAGAGCCATGGAGGGAAGAGGGG - Intronic
950520890 3:13497105-13497127 ATCCGCTTTGGTGGGTGGAGAGG - Intronic
953413059 3:42701052-42701074 AAGAGCCTTGATGGGTGGGGTGG - Intronic
954739708 3:52738727-52738749 AACAGCCCTGCTGGGTACGGTGG - Intronic
954928782 3:54261762-54261784 ACTATCCTTGGTGTGTAGAGGGG + Intronic
955203273 3:56872172-56872194 AACAGTCTTTGTGGGGAAAGGGG + Intronic
958461477 3:94402850-94402872 TAGAGCCTGGGTAGGTAGAGAGG - Intergenic
958739855 3:98056144-98056166 AACAGCCTTGGAGGGCAGCTGGG + Intergenic
961780835 3:129319244-129319266 ACCAGCCTTGGTGGGCACACGGG + Intergenic
962438883 3:135393725-135393747 AGCAGCCTTGATGGGCAGTGTGG + Intergenic
964728445 3:159839674-159839696 AGCAGCCTTAGTGGGTAGGAAGG + Intronic
966689139 3:182725625-182725647 AATAGCCTAGGTGGACAGAGGGG + Intergenic
967011984 3:185444045-185444067 AACAGGCTAGCTGGGTGGAGTGG + Intronic
967357027 3:188582998-188583020 GAAAGCCTTGGTGGATAGATTGG - Intronic
968151048 3:196336878-196336900 AAAAGCCTTGCTGGGTGGCGAGG - Intronic
969731189 4:8959100-8959122 AAGAGCCAGGGTGGGAAGAGGGG - Intergenic
970008456 4:11432288-11432310 AACAGCCATGATGGGAAGAAAGG - Intergenic
973306256 4:48654402-48654424 TACTGCCTGGGTGTGTAGAGAGG - Intronic
974309967 4:60192531-60192553 AACAGCATTGCTGGGTTGATTGG - Intergenic
977897818 4:102384165-102384187 ATCAAGCTTGGTGGGGAGAGGGG - Intronic
979559647 4:122087798-122087820 AAGAGCCTTGCTGGGTAAGGTGG - Intergenic
979722350 4:123916174-123916196 AATAGCCTTGGTTGGTTAAGTGG + Intergenic
979754699 4:124326290-124326312 AACAGACTTGGTGTCTGGAGAGG - Intergenic
980803423 4:137782687-137782709 AACTGCCTTGGTGGTTACACAGG + Intergenic
981400285 4:144305972-144305994 AAGAGCCTTGGTGGGCAAGGAGG - Intergenic
981471997 4:145146684-145146706 AACAGCAATGGGAGGTAGAGGGG + Intronic
982112677 4:152071150-152071172 AACACACTTGGTGGGCAGAGAGG + Intergenic
985451912 4:190067445-190067467 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
985452901 4:190070736-190070758 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
985453888 4:190074029-190074051 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
985454876 4:190077322-190077344 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
985455864 4:190080619-190080641 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
985456847 4:190083913-190083935 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
985457835 4:190087209-190087231 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
985458823 4:190090506-190090528 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
985463075 4:190173269-190173291 ACCAGCCTGGGAGGGTGGAGGGG - Intergenic
985968360 5:3354787-3354809 ATCACCCTTGGTGAGCAGAGGGG - Intergenic
986249024 5:6039065-6039087 CTCAGCCTTCTTGGGTAGAGTGG + Intergenic
988571733 5:32374128-32374150 GACACCCTGGGTGGGTAGAGGGG + Intronic
990412088 5:55551499-55551521 AACAGCCTTTGTGGGGATGGGGG + Intergenic
992636686 5:78731370-78731392 AAAAGCCTTGATGGGTAAAAGGG + Intronic
995923992 5:117347154-117347176 AACTGCCTTGGAAGTTAGAGTGG - Intergenic
995972878 5:117994123-117994145 AACAAACTTGGTGGATAGAAAGG - Intergenic
996800890 5:127401460-127401482 AACTGCCTTTGTGGGTAGCCAGG + Intronic
997401757 5:133608991-133609013 AACAGCCCTGTTGGGAAGAATGG + Intronic
997477654 5:134154865-134154887 AATAGCCTTGGTTTGGAGAGTGG - Exonic
1002474018 5:179453752-179453774 AACAGCCTTGGTGGAGAGGTGGG - Intergenic
1002582269 5:180216008-180216030 AACAGCCTGGCTGGGCAGAGTGG + Intergenic
1003487015 6:6588648-6588670 AACTGCCTTGGTGAGGGGAGAGG + Intronic
1004135598 6:12963028-12963050 AACAGAATTGGTCAGTAGAGAGG + Intronic
1005358760 6:25010269-25010291 ACCAGCTCTGGTGGGAAGAGGGG - Intronic
1005628670 6:27687209-27687231 AACAGTCGTGGTAGGAAGAGGGG + Intergenic
1006093688 6:31642970-31642992 ATCAGCCATGGAGGGTTGAGGGG + Exonic
1006831398 6:36970360-36970382 CACAGCCTTGGTAGGTAGAGTGG + Intronic
1008964003 6:57296029-57296051 AACAGGATGGGTGGGGAGAGGGG + Intergenic
1009797625 6:68492149-68492171 ACAAGCCTGGGAGGGTAGAGGGG + Intergenic
1010352504 6:74891080-74891102 AGCAGCATCGGTGGGTAGCGGGG + Intergenic
1010649675 6:78437666-78437688 AACAGCCTGGGAGGGGAAAGAGG - Intergenic
1013571025 6:111425537-111425559 AATAAACTGGGTGGGTAGAGAGG + Intronic
1015993159 6:138969574-138969596 TACAGCCTTGCTGGGTACGGTGG - Intronic
1018916756 6:168137165-168137187 GACAGCCTAGGTGTATAGAGGGG - Intergenic
1019576273 7:1739170-1739192 GACCGCCTTGGTGGTTAGCGAGG + Intronic
1023715727 7:43042353-43042375 AGGGGCCCTGGTGGGTAGAGGGG - Intergenic
1026129322 7:67607038-67607060 AACTACCTGGGTGGGCAGAGAGG + Intergenic
1026331872 7:69359188-69359210 AACATCATTGGTAGGTGGAGTGG - Intergenic
1027795717 7:82691165-82691187 CACAGCCTGGGTGGGCTGAGTGG - Intergenic
1028081381 7:86581532-86581554 AATAGACAAGGTGGGTAGAGGGG + Intergenic
1028983779 7:96994158-96994180 AGCAGCCTTGGTGTGCAGAAGGG - Intergenic
1030233812 7:107236751-107236773 AGCAGCATTGGTGGGGAGAGGGG - Intronic
1030866935 7:114711429-114711451 ACTAGCCTGGGTGGGTGGAGGGG + Intergenic
1032447446 7:131996754-131996776 CACAGGCTTGGTGGGGAGACTGG - Intergenic
1034304390 7:150038031-150038053 AAGAGCCATGGGGGGAAGAGGGG + Intergenic
1035089204 7:156292265-156292287 AACAGCATTGGTGAGTTGTGGGG - Intergenic
1036590709 8:10165514-10165536 ACCAGGCTGGGTGGGGAGAGGGG + Intronic
1036688637 8:10927656-10927678 CCCGGCCTTGGTGGGCAGAGGGG - Intronic
1040967867 8:53102155-53102177 AAAAGATATGGTGGGTAGAGAGG - Intergenic
1041279554 8:56196991-56197013 CACAGCCCTGGAGGGGAGAGAGG - Intronic
1043647241 8:82536208-82536230 CTCAAGCTTGGTGGGTAGAGGGG - Intergenic
1045020261 8:98037018-98037040 AACAGCCTCGGTGTGTAGTGGGG - Intronic
1045820895 8:106336626-106336648 AAAAGATTTAGTGGGTAGAGGGG - Intronic
1049322813 8:142006047-142006069 ACCAGCCTTGTTGGGGAGGGGGG - Intergenic
1055361250 9:75492841-75492863 AACAGCCTGGGTAGTTTGAGGGG + Intergenic
1059670003 9:116482762-116482784 AACATCCATGGTGGGAACAGAGG - Intronic
1060175021 9:121491373-121491395 GACAGCCCTGGTGGCTGGAGGGG - Intergenic
1060967205 9:127717900-127717922 ACCAGCCTTGGAGGTGAGAGGGG - Intronic
1186761685 X:12729752-12729774 AAGAGCCTTGGTGGGCATGGAGG - Intergenic
1187072794 X:15904734-15904756 AATTCCCTTGGTGGGTGGAGGGG - Intergenic
1187458422 X:19463750-19463772 AAAAGCCTTCGTGCGTTGAGTGG - Intronic
1188515296 X:30979401-30979423 AGCAGGCTTGGTGAGGAGAGGGG - Intergenic
1192216234 X:69161293-69161315 AACGGCCTTGGTCTTTAGAGTGG + Exonic
1192259003 X:69492718-69492740 TTCTGGCTTGGTGGGTAGAGTGG + Intergenic
1195770721 X:108348096-108348118 AACAGTCTTTGTGTGTACAGTGG + Intronic
1198221920 X:134610334-134610356 GACACCATTGGTGGGTTGAGGGG - Intronic
1198865521 X:141119511-141119533 AGCAGGCTTGGTGTGTAGTGAGG + Intergenic
1198942647 X:141974672-141974694 GAAAGCCATGGTGGCTAGAGTGG + Intergenic
1199656987 X:150006001-150006023 CAGAGCCTTGCTAGGTAGAGTGG - Intergenic
1199721444 X:150545551-150545573 ATCAACCTTGGAGGGTGGAGTGG - Intergenic
1200126370 X:153816663-153816685 AGCTGCCTGGGTGGGTAGAGTGG + Intronic
1202083417 Y:21108809-21108831 AGCACCCTTGAGGGGTAGAGTGG - Intergenic