ID: 1148722296

View in Genome Browser
Species Human (GRCh38)
Location 17:49763049-49763071
Sequence AGCCTTGGTGGGTAGAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 409}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722284_1148722296 13 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409
1148722279_1148722296 21 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409
1148722281_1148722296 20 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409
1148722285_1148722296 7 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409
1148722288_1148722296 -10 Left 1148722288 17:49763036-49763058 CCCCGGACAAAACAGCCTTGGTG 0: 1
1: 0
2: 1
3: 18
4: 249
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409
1148722283_1148722296 14 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409
1148722282_1148722296 15 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG 0: 1
1: 0
2: 6
3: 25
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722296 Original CRISPR AGCCTTGGTGGGTAGAGGGG TGG Intronic
900104329 1:975940-975962 AGTCTGGGTGGGTGGAGGGCAGG - Exonic
900376421 1:2356896-2356918 AGCCTTGGGGGGCAGAGTTGGGG + Intronic
900710757 1:4112061-4112083 AGCCGTGGAGGGCAGAGAGGAGG + Intergenic
902113048 1:14099016-14099038 AGGCTTGGTGGGGAGAAAGGAGG + Intergenic
902239711 1:15080422-15080444 ACCCTTGGTGGGCAGCGAGGTGG - Intronic
902676947 1:18015411-18015433 AGCCTTGGCAGATAGAGAGGAGG + Intergenic
904019329 1:27450449-27450471 CAGCTTGGTGGGTAGATGGGTGG - Intronic
904322134 1:29704596-29704618 AAGCTAGGTGGGTGGAGGGGTGG + Intergenic
904487902 1:30839879-30839901 TGGGTTGGTGGGTAGATGGGTGG + Intergenic
904599490 1:31665727-31665749 AGCCATGGTGGGCAGAGGGGAGG - Intronic
904648614 1:31987446-31987468 AGCCTGGGTGGGGAGGGGGCAGG - Intergenic
904977772 1:34471754-34471776 AGCCTTGTTGGGCAGAGGAAGGG + Intergenic
905309927 1:37042333-37042355 AGCCAAGGTGGGTAGGGGTGAGG - Intergenic
905982369 1:42241407-42241429 AGCTTTGGTGGGCAAAGTGGGGG - Intronic
907035848 1:51215498-51215520 ACCTTTGGAGGGCAGAGGGGAGG + Intergenic
907342642 1:53747881-53747903 AGCCTTGGTGTCTGAAGGGGCGG - Intergenic
909663666 1:78110729-78110751 AGGCTAGATGGGTAAAGGGGAGG - Intronic
910439742 1:87240223-87240245 AGCCATGGTGGGTGGATGGATGG - Intergenic
910978228 1:92930855-92930877 AGTCTTAGTTGGTATAGGGGAGG - Intronic
913062515 1:115221125-115221147 AGAATTTGTGGGCAGAGGGGTGG + Intergenic
913120006 1:115731302-115731324 AGCCTTAGTTTTTAGAGGGGTGG - Intronic
913283651 1:117208675-117208697 AGCCATGATGGGGAGAGGGGAGG + Intronic
913415341 1:118599261-118599283 AGCCTTAGTGGGTAATGGGGTGG + Intergenic
913564352 1:120057394-120057416 AGCTTTGGTGGGGAGAAGGTTGG - Intronic
913633776 1:120736170-120736192 AGCTTTGGTGGGGAGAAGGTTGG + Intergenic
914284939 1:146216743-146216765 AGCTTTGGTGGGGAGAAGGTTGG - Intronic
914545970 1:148667482-148667504 AGCTTTGGTGGGGAGAAGGTTGG - Intronic
914620594 1:149403184-149403206 AGCTTTGGTGGGGAGAAGGTTGG + Intergenic
915680106 1:157573129-157573151 AGCCTTGGTGGATATCAGGGAGG + Intergenic
916488104 1:165277322-165277344 AGCCCTGGTGGAGAGTGGGGAGG - Intronic
916548025 1:165825208-165825230 TGCCTTGATGGATAGAGGGATGG + Intronic
917309971 1:173668849-173668871 AGCATTGGAGGGAAGAGGGAAGG + Intronic
917824399 1:178801801-178801823 TGACTTGATGGGTAGAAGGGAGG + Intronic
917828597 1:178851877-178851899 AGAATTGTTGGGTGGAGGGGAGG + Intronic
917962853 1:180158191-180158213 AGCCTGGGCAGGTAGAGAGGTGG + Intronic
918463354 1:184797651-184797673 AGCTTTGGTGGGTGGGGGGCAGG + Intronic
919866976 1:201789826-201789848 AGCATGGGATGGTAGAGGGGAGG - Intronic
919934135 1:202240571-202240593 TGTGTTGGTGGGAAGAGGGGAGG + Intronic
920237258 1:204516454-204516476 AGCCCGGGTGGGGGGAGGGGTGG - Exonic
920434019 1:205936638-205936660 AGCTCTGGGAGGTAGAGGGGTGG - Intronic
921874188 1:220175717-220175739 AGTGATGGTGGGTAGAGGAGAGG - Intronic
923339539 1:232995883-232995905 AGCCTGGGTGGGGGGAGAGGAGG - Intronic
923473984 1:234315987-234316009 AGCCTTGGTGGGTAGGGTGGAGG + Intronic
923649856 1:235864338-235864360 AGGTTTGGTGGGGAGAAGGGTGG - Intronic
923778750 1:237002616-237002638 AGCTGTGGTGGGCAGAAGGGCGG - Intergenic
923932629 1:238720203-238720225 AGCCTGGGGTGGTAGAGGGTGGG + Intergenic
1067564379 10:47326168-47326190 ACCCTTGGGGAGTAGAGGGAAGG + Exonic
1067786514 10:49253479-49253501 AGCCCTGGAGGGTGCAGGGGTGG - Intergenic
1067786572 10:49254716-49254738 AGCCCTGGAGGGTGCAGGGGTGG - Intergenic
1068587100 10:58811919-58811941 AGCCGAGGTGGGTAGGGTGGGGG + Intronic
1069328890 10:67266334-67266356 AGCCATGGAGGGGACAGGGGAGG - Intronic
1070122651 10:73593734-73593756 ATCCTTGGAGGGTAGTGGGGAGG + Intronic
1070287745 10:75095880-75095902 ACCCTTGGTGGGTGGTGGGCGGG - Intronic
1070482532 10:76896731-76896753 AGGGTTGGTGGGTTGATGGGTGG + Intronic
1070662250 10:78315468-78315490 AGCTGTGGTGAGTAGAGTGGTGG + Intergenic
1070833063 10:79432083-79432105 AGCCTGTGAGGGAAGAGGGGAGG - Intronic
1072583535 10:96761273-96761295 AGCCTTGGGAGAGAGAGGGGGGG - Intergenic
1072679804 10:97498666-97498688 TGGCTGGGTGGGGAGAGGGGCGG + Exonic
1073050407 10:100663468-100663490 AGCAGGGGTGGGCAGAGGGGAGG - Intergenic
1073059959 10:100727776-100727798 AGAGTTGGAGGGTACAGGGGAGG + Intergenic
1073088065 10:100908105-100908127 AGCCTCAGTGAGGAGAGGGGCGG - Intergenic
1073792257 10:106952409-106952431 GGCCTGGGTGGGTAGAGGACAGG - Intronic
1074158083 10:110815605-110815627 AGCCTTGGGGGAGAGAGGGTTGG - Intronic
1075097410 10:119481628-119481650 AGCCTCAGGGGGTAGAAGGGGGG - Intergenic
1075258668 10:120944832-120944854 AGCCCTGGTGGGCAGGGGTGGGG - Intergenic
1075446239 10:122515424-122515446 AGCCTTGGTGAGTTTAGAGGAGG + Intergenic
1075512190 10:123081512-123081534 AACCTGGCTGGGGAGAGGGGCGG - Intergenic
1075610914 10:123853974-123853996 AGCCAGGGTGGGGAGAGGGAGGG - Intronic
1075806710 10:125194236-125194258 AGCCTGGGCTGGGAGAGGGGAGG + Intergenic
1076022373 10:127084746-127084768 TGCCTTGGTGGGTGGAGGACAGG - Intronic
1076267208 10:129118280-129118302 ACCCTTGGTGGGTGGATGGATGG - Intergenic
1076629653 10:131844649-131844671 AGCCAGGGTGGGAAGAGGGGTGG - Intergenic
1077113109 11:870550-870572 AGCCTTTGGGGGTACAGGGTGGG - Intronic
1077310798 11:1888294-1888316 GGCCCTGGTGGGGAGAGTGGAGG - Intronic
1077463546 11:2722797-2722819 AGCCTGGTGGGGTAGAGGGAAGG - Intronic
1077575790 11:3382330-3382352 AGTCTTGGGGGGCAGAAGGGGGG + Intergenic
1077837069 11:5934755-5934777 AGGCTTTGTGGATAGAAGGGCGG + Intronic
1077843242 11:5997486-5997508 AGCCCTGGTGGGCTGTGGGGAGG - Intergenic
1078433479 11:11305493-11305515 ATCCATTGTGGGTGGAGGGGAGG + Intronic
1078565237 11:12408803-12408825 TGGCTTGGTGGGAAGCGGGGTGG + Intronic
1081611167 11:44564530-44564552 AGCCTGGGAGGGCAGAGGGCTGG + Intronic
1081663263 11:44901444-44901466 TGCCTGGGTGGGCAGAGGGAGGG + Intronic
1081996359 11:47367068-47367090 GGGCTTGGTAGGTAGAGGGAAGG + Intronic
1083051372 11:59779760-59779782 AGCCTGGCTGGGGTGAGGGGTGG + Intronic
1083259952 11:61517510-61517532 AGCATTGGGGGATGGAGGGGTGG + Intronic
1083615621 11:64024694-64024716 AGCCTTGGCGGGTGGGAGGGTGG + Intronic
1084155622 11:67311130-67311152 AGGCGTGGTGGGTTGATGGGCGG + Intronic
1084596618 11:70120452-70120474 GGCCCTGTTGGGGAGAGGGGTGG + Intronic
1085505409 11:77056064-77056086 TGCCTTGGTGTGTTGAAGGGCGG + Intergenic
1085508008 11:77071136-77071158 AGCCTCGGTGGGCACTGGGGTGG - Intronic
1085880266 11:80459251-80459273 AGCCATGGTGGTTAGAAGAGAGG - Intergenic
1088712421 11:112520472-112520494 AGCCTTGCTGGGGACAGGGCTGG + Intergenic
1089067791 11:115675065-115675087 AGCCTTGGCCTGCAGAGGGGAGG + Intergenic
1089178232 11:116563455-116563477 GGCATTGGTGGGTGGAGTGGTGG - Intergenic
1089459110 11:118642357-118642379 AGCTTTGGCGGGCAGAGGCGGGG - Exonic
1090022515 11:123140558-123140580 AGGGTTCGGGGGTAGAGGGGAGG - Intronic
1090397972 11:126431731-126431753 GGGCTTGGTGGGTGGAGGAGAGG + Intronic
1090445179 11:126758562-126758584 CACTTTGGTGGGGAGAGGGGAGG - Intronic
1091229752 11:133980730-133980752 GGCCGTGGTGGGGAGTGGGGTGG - Intergenic
1091370790 11:135056375-135056397 AGCCTGGGAGGGTAAAGAGGAGG - Intergenic
1092570595 12:9717037-9717059 GGACTTGCTGGGTAGAGGGATGG - Intronic
1092818350 12:12330567-12330589 AGCATTGGTGGGTAGAAGGGTGG + Exonic
1094514364 12:31118754-31118776 AGCCAGGGGGGGAAGAGGGGCGG - Intergenic
1095054377 12:37582237-37582259 AAGCCTGGTGGGTAGAGGGGTGG + Intergenic
1095268098 12:40183549-40183571 GGCCATGATGGGAAGAGGGGAGG + Intergenic
1096298157 12:50401334-50401356 AGCATTGGGGGGTTGGGGGGCGG + Intronic
1096409090 12:51364526-51364548 CGCCTTTGGGGGTAGAGGGGTGG - Intronic
1098077900 12:66753060-66753082 AGCATTGGTGGGTAGGGGCTGGG - Intronic
1098678601 12:73321762-73321784 AGCCTTGGTGGGCACAGAGCTGG + Intergenic
1099240642 12:80134695-80134717 AGCTTTGGTGGGAAAGGGGGAGG - Intergenic
1100120807 12:91367361-91367383 AGCATGGGTGGGTATAGAGGTGG - Intergenic
1101718535 12:107331858-107331880 AGCCATGGTGGATGGAGGGCAGG + Intronic
1102473723 12:113175155-113175177 AGCCTGGAAGGGTAGAGGGCAGG + Exonic
1102687381 12:114735437-114735459 AGCCCTGTTGGGAAGAGGGCTGG - Intergenic
1102868704 12:116395083-116395105 AGCTTAGGTGGGTTGAAGGGTGG - Intergenic
1102955878 12:117058772-117058794 AGCTTGGCTGGGGAGAGGGGAGG + Intronic
1103057460 12:117833018-117833040 AGCCTTCGTGGGGCGGGGGGTGG + Intronic
1104114959 12:125740779-125740801 AGGCTTGGTGGGCAGAGCGAGGG - Intergenic
1104326005 12:127799411-127799433 TGCCTATGTGAGTAGAGGGGTGG - Intergenic
1104778167 12:131403400-131403422 GGCCTTGGTGGACAGAGTGGTGG + Intergenic
1104979939 12:132569270-132569292 TGCCTAGGTGGGCAGAAGGGTGG + Intronic
1105515776 13:21089639-21089661 AGAAGTGGAGGGTAGAGGGGTGG + Intergenic
1107389151 13:39945324-39945346 GGCCCTGGTGGGCAGAGAGGTGG - Intergenic
1108548454 13:51519748-51519770 AGCCTGGGTGGGTACTAGGGAGG - Intergenic
1109217265 13:59603758-59603780 AGCCATGGTGGATAGAGGTGGGG - Intergenic
1113091120 13:106618362-106618384 AGTGTTGGTGGGTTGGGGGGTGG - Intergenic
1113768737 13:112895615-112895637 AGCCTCCGTGGGTAGCTGGGGGG + Intronic
1114306524 14:21428602-21428624 TGCCTGGGCGGGGAGAGGGGAGG + Intronic
1114626904 14:24136151-24136173 CGCCTTCCTGGGTAGTGGGGCGG - Intronic
1116586159 14:46707336-46707358 AAACTTGGGGGATAGAGGGGTGG + Intergenic
1118011711 14:61616425-61616447 AGCCTGGCTGGGTGGAGGGAGGG + Intronic
1118691787 14:68346945-68346967 AGCCTTGGGGGGTAGAGGGAAGG - Intronic
1119019085 14:71091082-71091104 AGCCATGGAGGGCTGAGGGGAGG + Intronic
1119428260 14:74549995-74550017 AGCCTGGGAGGGAAGGGGGGTGG - Intronic
1119713248 14:76838349-76838371 ACCCTTGGTGTGGAGAGGAGGGG - Intronic
1122189520 14:100029674-100029696 AGCCTTGGAGGGTATAGGATTGG + Intronic
1123067653 14:105626618-105626640 GGCCTTGGAGGGCAGAGGGCAGG - Intergenic
1123071672 14:105645343-105645365 GGCCTTGGAGGGCAGAGGGCAGG - Intergenic
1123091336 14:105743619-105743641 GGCCTTGGAGGGCAGAGGGCAGG - Intergenic
1123097105 14:105771959-105771981 GGCCTTGGAGGGCAGAGGGCAGG - Intergenic
1125241908 15:37585879-37585901 AGCCGTGGAGGGTGGAGGAGGGG - Intergenic
1125887657 15:43240698-43240720 AGCCTTGGTGGGGGGTGGGTGGG + Intronic
1129331222 15:74828399-74828421 AGGCTTGGTGGGGATATGGGGGG - Intronic
1129411728 15:75354197-75354219 AGCCTGGGTTGGCACAGGGGCGG - Intronic
1131605835 15:93901275-93901297 AGCCAGGGTGGGTGGAGGGCCGG - Intergenic
1132351511 15:101142325-101142347 TGAATAGGTGGGTAGAGGGGTGG - Intergenic
1132375664 15:101326781-101326803 AGCCTGGAGGGGTAGCGGGGAGG + Intronic
1132726692 16:1341967-1341989 ATCCCTGGTGGGGACAGGGGAGG - Exonic
1132913630 16:2329601-2329623 AGCCTGTGTGGGAAGGGGGGTGG - Intronic
1133232668 16:4373840-4373862 AGCAGAGGTGTGTAGAGGGGAGG + Intronic
1133383078 16:5347588-5347610 AGCATGGGTGGGTGGATGGGTGG - Intergenic
1133979449 16:10622443-10622465 AGCCTTGCTGGGTGGGGGTGGGG + Intergenic
1134311951 16:13083087-13083109 AGTGCTGGTGGATAGAGGGGAGG + Intronic
1136149692 16:28339281-28339303 AGCCTTGGGGGGTAAATGAGTGG - Intergenic
1136633978 16:31507815-31507837 AGTCTTGCTGGGCATAGGGGTGG - Exonic
1137444947 16:48525988-48526010 AGTTATGCTGGGTAGAGGGGAGG - Intergenic
1137562009 16:49508808-49508830 AGCGTTGGTGGGAAGCGTGGTGG - Intronic
1138127029 16:54447504-54447526 AGCGTTAGTGGGTAGAGGCCAGG + Intergenic
1138641555 16:58391959-58391981 GGACGGGGTGGGTAGAGGGGTGG - Intronic
1138679114 16:58672273-58672295 ACCCTGGGAGGGTAGTGGGGTGG + Intronic
1138819783 16:60245097-60245119 AGTCTTTGTGTGTGGAGGGGAGG + Intergenic
1139344764 16:66295866-66295888 AGCCTTGCAGAGAAGAGGGGAGG + Intergenic
1139474802 16:67197805-67197827 GGCTTTGGTGGGTGGAGAGGTGG + Intronic
1141632705 16:85297122-85297144 AGCCTGGCCGGGTAGAGGGCGGG - Intergenic
1141827850 16:86493611-86493633 AGCTTTGGTGGGTGGGGGGGGGG - Intergenic
1142245275 16:88967496-88967518 AGCCGTGGTGGGGTGTGGGGTGG + Intronic
1142247703 16:88977368-88977390 AGCCCTGGGGGGAAGATGGGTGG - Intergenic
1142728241 17:1831954-1831976 AGCCTGGGGCGGTAGTGGGGGGG - Intronic
1143068143 17:4265978-4266000 AGCATTAGTGGGTAGTGAGGTGG + Intergenic
1143481509 17:7229979-7230001 AGCCTTGGTGGGGTGAGCAGGGG - Intronic
1143995613 17:11003949-11003971 GGCCATGGTGGGTAGGGGTGGGG - Intergenic
1144581480 17:16461797-16461819 TGGCTTGGTGGGTAGAGAGAGGG + Intronic
1144739139 17:17571515-17571537 AGCCTGGGAGGGAAGAGGGAAGG + Intronic
1144763394 17:17720138-17720160 AGGCAGGGTGGGTAGAGGGCTGG - Intronic
1145374918 17:22338300-22338322 AAGCCTGGTGGGGAGAGGGGTGG + Intergenic
1145833385 17:27935673-27935695 ACCCATGCTGGGTAAAGGGGAGG + Intergenic
1146213243 17:30958100-30958122 AGCCTAGGTGTGTATGGGGGAGG - Exonic
1146274035 17:31503505-31503527 AGCCTGGCAGAGTAGAGGGGAGG + Intronic
1146474869 17:33154619-33154641 AGGCCTGGTGGATAGAGGGCAGG - Intronic
1146499502 17:33352371-33352393 AGCCTTGGGGGGTAATGGGCTGG - Intronic
1147241796 17:39095371-39095393 AGGCTTGGGGGGTTGGGGGGGGG - Intronic
1147574910 17:41593450-41593472 AGGCTTGGCGGGGAGAGGGATGG - Intergenic
1148722296 17:49763049-49763071 AGCCTTGGTGGGTAGAGGGGTGG + Intronic
1151827078 17:76529628-76529650 AGCCTGCGTGGGGAGAGGGGTGG + Intronic
1153255942 18:3171355-3171377 TGCCTTAGGGGGTAGAGGTGAGG + Intronic
1153804549 18:8700973-8700995 AACCTTGGCGGGTGGTGGGGAGG + Intergenic
1156135324 18:34030970-34030992 AGTCATGGTGGGGAGAGGGAGGG + Intronic
1156268063 18:35506033-35506055 GGCCTTGGTGGGGACAGGGTGGG + Intergenic
1156359477 18:36371796-36371818 AGCCCTGGTGGAGAGAGGTGAGG + Intronic
1157370856 18:47110004-47110026 AGCCCTGGTGGCTACAGGGCAGG - Intronic
1157598496 18:48878277-48878299 AGCCATGGTGGGCTCAGGGGAGG + Intergenic
1157614901 18:48980645-48980667 GGCCTTGGTTTGTGGAGGGGTGG + Intergenic
1158447569 18:57534444-57534466 AGACTGGGTGGGAGGAGGGGAGG - Intergenic
1158518753 18:58152764-58152786 AGTCTTGGTAGGTAGAAGAGTGG - Intronic
1158659342 18:59371956-59371978 AAGCTTGGTGGGTGGAGGGGTGG - Intergenic
1159920678 18:74224741-74224763 AGCATGGGTGGGGATAGGGGTGG - Intergenic
1160799364 19:960656-960678 GGCCCTGGTGGGAAGAGGGGAGG - Intronic
1162031796 19:7920706-7920728 AGCCTGGGCGGGGTGAGGGGCGG + Intronic
1162575785 19:11498007-11498029 AGCACTGGTGGTTAGAGGGGAGG - Intronic
1163350691 19:16774791-16774813 AGGATAAGTGGGTAGAGGGGTGG - Intronic
1163675480 19:18653581-18653603 TGCCTAGGTGGGTAGATGGTAGG - Intronic
1165820291 19:38670512-38670534 AGCCTGGGTGGGGACTGGGGTGG + Intronic
1166082450 19:40452506-40452528 AGCCTGGGTGGCAAGAGGGAAGG - Intronic
1166265823 19:41683663-41683685 AGCCTGGGTGCCTAGAGGTGAGG + Intronic
1166267232 19:41691811-41691833 AGCATGTGTGGGTAGAAGGGAGG + Intronic
1166390449 19:42406386-42406408 AGCCTGGTTTGGGAGAGGGGTGG + Exonic
1166666352 19:44682722-44682744 AGGCTTGGGGGGACGAGGGGAGG - Intronic
1167240547 19:48340713-48340735 AACCATGGAGGGCAGAGGGGAGG - Intronic
925919109 2:8627322-8627344 AGCCTTGGAGGTTTGATGGGGGG - Intergenic
927262120 2:21102287-21102309 GGCCTTGGTGGTTCTAGGGGAGG + Intergenic
927639830 2:24839567-24839589 CCCCTTAGTGGGTAAAGGGGAGG + Intronic
927691979 2:25215102-25215124 AGCCTGGGTGGGAAGCAGGGTGG - Intergenic
928366837 2:30709384-30709406 AGCCTTGATGGGTGGAGGAAAGG + Intergenic
928656402 2:33456061-33456083 AACTTTGGTGGGAAGAGGAGAGG - Intronic
929789692 2:45013760-45013782 AGGCCTGGAGGGCAGAGGGGTGG - Intergenic
930208020 2:48607764-48607786 AGCGTGGGTGGGGAGGGGGGAGG + Intronic
930589608 2:53311857-53311879 AGCCTTAGTCATTAGAGGGGAGG - Intergenic
930621610 2:53649942-53649964 AGCTTTGGCGGGGAGATGGGGGG - Intronic
931286639 2:60837601-60837623 AGCCTTGTTGGGGTGAGGAGAGG - Intergenic
931460778 2:62448433-62448455 AGCCTCAGAGGATAGAGGGGAGG + Intergenic
932413463 2:71560421-71560443 ATGCTCGGTGGGTAGCGGGGCGG - Intronic
934114030 2:88766468-88766490 AGGCTTGGGGGGTAGGGGTGTGG + Intergenic
934653357 2:96104592-96104614 GGCCTTGGTGGGGAGCAGGGAGG - Intergenic
934766989 2:96885243-96885265 GGCCCTGCTGGGTAGAGAGGTGG + Intronic
934797648 2:97114208-97114230 AGGCTTGGGGGGTAGGGGCGTGG + Intronic
934835766 2:97589231-97589253 AGGCTTGGGGGGTAGGGGCGTGG - Intronic
936275331 2:111091174-111091196 AGGCTTAGAGGGTAGAGGGCAGG - Intronic
936978705 2:118244061-118244083 AGACTTGGAGGGCAGAGGTGAGG + Intergenic
937234070 2:120419845-120419867 TGGATAGGTGGGTAGAGGGGTGG - Intergenic
939960284 2:148560059-148560081 AGTGATGGTGGGTAGAGGTGTGG - Intergenic
943245701 2:185448241-185448263 AGACTTAGAGGGTAGAAGGGTGG + Intergenic
944358328 2:198820547-198820569 AACCTTATTGGGAAGAGGGGTGG - Intergenic
946051819 2:216869248-216869270 GGCCATAGTGGGTGGAGGGGTGG - Intergenic
947740620 2:232483235-232483257 TTCCTTGGTGGGTAGGGTGGGGG - Intronic
948144587 2:235699072-235699094 AGCCTAGGTGGGGTGGGGGGGGG - Intronic
948176381 2:235946794-235946816 TGCCTGGCTGGGCAGAGGGGCGG - Intronic
948650635 2:239441306-239441328 AGCCTTGGGGGGCAGGGAGGTGG - Intergenic
1169140339 20:3224100-3224122 AGCCTTGCTGGGTTGGGGGCTGG + Intergenic
1169198648 20:3697036-3697058 GGACTTGGAGGGTGGAGGGGTGG - Intronic
1169983811 20:11419459-11419481 GGTCTTGGTGGGTAAAGGTGTGG - Intergenic
1171024148 20:21613711-21613733 AGCCAGGGTGGGTTGTGGGGTGG - Intergenic
1172481645 20:35275079-35275101 AGCCTTGGAGGACAGTGGGGTGG - Exonic
1173524656 20:43722342-43722364 ACCCTTCGTGGGTGGAGAGGGGG - Intergenic
1174386011 20:50189175-50189197 ACCCTTGGTGGGTAGGAGGCAGG - Intergenic
1174409231 20:50322775-50322797 AGTCTTGATGGGTGGAGGGATGG - Intergenic
1174915548 20:54649518-54649540 AGCCTTGGTGAGTAAATGTGTGG - Intronic
1175089943 20:56494118-56494140 AGCCCTGGTGTGTAGGGAGGTGG - Intronic
1176061879 20:63176040-63176062 ACCCTTGGTGAGAAGAGGGCTGG + Intergenic
1176115331 20:63429576-63429598 AGCCTGGGTGGGCAGAGGCAGGG - Intronic
1176382957 21:6122469-6122491 AGCCTAGGTGGGGGGTGGGGAGG - Exonic
1178117939 21:29436514-29436536 AGACTTGGTGGGTCTGGGGGTGG + Intronic
1178877693 21:36425410-36425432 AGCCGTGGTGGGTCGGGGGATGG - Intergenic
1179740512 21:43415770-43415792 AGCCTAGGTGGGGGGTGGGGAGG + Exonic
1180138576 21:45877014-45877036 TGCCTTGGAGTGTAGAAGGGCGG - Intronic
1180232158 21:46433435-46433457 AGCCTTGGAGAGTAGGGAGGTGG + Intronic
1180709736 22:17831692-17831714 AGACATGGGGGGCAGAGGGGAGG - Intronic
1181102312 22:20549716-20549738 AGGCTTAGTGGGGAGCGGGGAGG - Intronic
1181484032 22:23219368-23219390 AGCCATGGTGGGGAGAGGCTTGG - Intronic
1181766157 22:25093586-25093608 ACACTTGGTGGGGAGCGGGGAGG + Intronic
1182722920 22:32418461-32418483 ACACTTGGTGGGTAGAGGCCAGG - Intronic
1182763656 22:32743224-32743246 AGCCCTGGTGGGGAAGGGGGCGG + Intronic
1182941591 22:34282240-34282262 AGATTTGGTGGGGAGAGCGGGGG - Intergenic
1183511162 22:38235895-38235917 AGCCGTGGTGGGAAGGGCGGTGG - Intronic
1183589881 22:38773832-38773854 TGCGTGGGTGGGTAGATGGGCGG - Intronic
1184110009 22:42389015-42389037 GGCCTGGGTGGGTGGAGGGTTGG - Intronic
1184374492 22:44103117-44103139 GGCCTTGGTGGGGCGAGGGCTGG + Intronic
1184737136 22:46405966-46405988 AGTCTGGGTGGCTGGAGGGGTGG - Intronic
1203288872 22_KI270735v1_random:15198-15220 AGCCTTGGTGGGTGTGGGGTAGG + Intergenic
950716015 3:14848268-14848290 AGTCTTGGAGGGAAGAGGCGCGG - Intronic
951338928 3:21459874-21459896 AGACTTGGAGAGTAGAGGGCTGG - Intronic
953413056 3:42701049-42701071 AGCCTTGATGGGTGGGGTGGGGG - Intronic
953569136 3:44057575-44057597 CGACTCGGTGGGGAGAGGGGAGG - Intergenic
953789507 3:45936692-45936714 AGATTTTGTGGGTAGAGGGAGGG + Intronic
954291164 3:49650808-49650830 GGCCTTGGTGGATAGAGGGCTGG - Exonic
954291170 3:49650829-49650851 GGCCTTGCTGGGCAGAGGGCTGG - Exonic
954305186 3:49721927-49721949 GGGCTGGGTGGGGAGAGGGGCGG - Exonic
954380501 3:50216458-50216480 ATTCCTGGTGGGTAGAGGAGGGG + Intronic
954418370 3:50405354-50405376 GGCCGTGGTGGGGAGGGGGGTGG + Intronic
954695625 3:52423537-52423559 ATCCTTGGTGGGAGGAGAGGAGG - Exonic
955347068 3:58169308-58169330 ATCTTTGGTGGGTAGGGGGTGGG + Intronic
956391025 3:68772694-68772716 TGCCTGGATGGGTAGAGGGAGGG + Intronic
956590679 3:70911528-70911550 TGCATTGGTGGGTAGAGGCCAGG - Intergenic
956758653 3:72416556-72416578 TACCTTGGTGGGAAGAGGGAGGG - Intronic
957199329 3:77112233-77112255 AGTTTTGGGGGGTGGAGGGGGGG + Intronic
957525250 3:81371718-81371740 GACCTTGGTGGGTGGATGGGTGG - Intergenic
957525285 3:81371860-81371882 GACCTTGGTGGGTGGATGGGTGG - Intergenic
957781289 3:84821042-84821064 AGCCATGGTAGGCAGTGGGGTGG - Intergenic
958582036 3:96039261-96039283 ATCCTTTGGGGGGAGAGGGGAGG - Intergenic
960483529 3:118223112-118223134 AGCCTTGGTAGCTAGAGAGGTGG + Intergenic
960677509 3:120210744-120210766 AGCCTTGGTGGTAATAGGAGAGG + Intronic
961224294 3:125225743-125225765 AGGAATGGTGGGGAGAGGGGAGG - Exonic
961234926 3:125357730-125357752 GGCCTTGGTTTGTAGAGGTGAGG - Intronic
961348922 3:126286788-126286810 GGCCATGATGGGAAGAGGGGTGG - Intergenic
962027172 3:131560501-131560523 GTCCTTTGTGGGAAGAGGGGTGG - Intronic
962312594 3:134337024-134337046 GGCCTTGGTGGGGATGGGGGAGG + Intergenic
962344033 3:134606825-134606847 TGCCGTGGAGGGGAGAGGGGAGG - Intronic
962375696 3:134857128-134857150 AGCCTTGGGGGGCAGGGAGGTGG + Intronic
962438886 3:135393728-135393750 AGCCTTGATGGGCAGTGTGGGGG + Intergenic
962955976 3:140267195-140267217 AACCTTGGTGGGTTAAGAGGAGG - Intronic
963370392 3:144392541-144392563 AGCCTAGGTGGGTTGAGATGGGG - Intergenic
964712618 3:159687262-159687284 AGTCTTGGTGGGGAGAGGAGTGG - Intronic
965961952 3:174440086-174440108 AGGCTGCGTGGGAAGAGGGGAGG - Intronic
966462814 3:180196484-180196506 GGCAATGGTGGGAAGAGGGGAGG - Intergenic
966766123 3:183464082-183464104 AGCCTTGGGAGTTAGAGAGGTGG - Intergenic
968272632 3:197416307-197416329 GGCCATGGTGGGTACAGGGAGGG + Intergenic
968456830 4:704595-704617 AGGCTTGGTGGCGAGAGGGGAGG - Intergenic
968702956 4:2065335-2065357 GGGCTGGGTGGGAAGAGGGGTGG + Exonic
968854841 4:3111955-3111977 AGCTTTGCTGGGGACAGGGGAGG - Intronic
968891110 4:3368952-3368974 GGCCATGGTAGGTAGAGGCGGGG + Intronic
969359719 4:6655650-6655672 GGGGTTGGTGGGGAGAGGGGAGG + Intergenic
969675179 4:8610530-8610552 AGCCTCGGGGGGTAGGAGGGTGG - Intronic
972367247 4:38387711-38387733 AGCCTAAGTGGGTGGAAGGGTGG + Intergenic
972579898 4:40385940-40385962 AGCATTGGTGAGGGGAGGGGAGG + Intergenic
973306255 4:48654399-48654421 TGCCTGGGTGTGTAGAGAGGTGG - Intronic
973642302 4:52915595-52915617 AGCCTGGGTGGGTGGATGGATGG - Intronic
974047107 4:56907762-56907784 CTCCTTGCTTGGTAGAGGGGCGG + Intergenic
977810052 4:101347464-101347486 TGCCTTGGTGAGTGGAGGAGCGG - Exonic
981204088 4:142018236-142018258 AGCATTGTTGGGGAGAGGGGTGG - Intergenic
982390463 4:154857945-154857967 ATCCTGGGTGGGTCGAGGAGTGG - Intergenic
982632103 4:157843628-157843650 AACATTGCTGGGTTGAGGGGTGG + Intergenic
985700516 5:1369123-1369145 GGCAGTGGTGGGTGGAGGGGTGG + Intergenic
986269192 5:6216695-6216717 AGCCTTGATGGGCAGTGGAGAGG + Intergenic
986347133 5:6846078-6846100 GGCCTCGGGGGTTAGAGGGGAGG - Intergenic
986347194 5:6846256-6846278 AGGCTTCGGGGGTGGAGGGGAGG - Intergenic
986657741 5:10031661-10031683 ATACTTAGTGGGGAGAGGGGTGG - Intergenic
987530142 5:19107673-19107695 AGCCTAGGAAGGTAGAAGGGAGG - Intergenic
991659267 5:68933893-68933915 AGCTGTGGTGGGAAGTGGGGTGG - Intergenic
992638166 5:78745572-78745594 AGCCTGGGTGGATGGATGGGAGG + Intronic
992704848 5:79380611-79380633 AGCCATGGTAGGTAGGGGCGGGG - Intronic
994059231 5:95455747-95455769 AGGCTTGATTGGTAGAGGTGAGG + Intergenic
995483527 5:112615957-112615979 AGCCTTGGTGAGTAGAAGTCTGG + Intergenic
997197427 5:131989255-131989277 AGCCAGGGTGGGAAGAGGAGTGG + Intronic
997358006 5:133276606-133276628 AACCATGGTGGGGAGTGGGGAGG - Intronic
997611222 5:135217177-135217199 AGCCTGGCAGGGTGGAGGGGGGG - Intronic
1000548070 5:162626010-162626032 AAGCTTGGTGGGGAGGGGGGAGG + Intergenic
1002190676 5:177475852-177475874 AGCCTTGGTGGGTGGGAGGCTGG + Intergenic
1003550466 6:7098367-7098389 AGGCTTAGTGGCTGGAGGGGTGG - Intergenic
1004465383 6:15880502-15880524 AACCTGGGTGGGTAAAGAGGTGG - Intergenic
1005709573 6:28490267-28490289 ATCCTAGGTGGGTAGATGGGAGG + Intergenic
1006093689 6:31642973-31642995 AGCCATGGAGGGTTGAGGGGTGG + Exonic
1006287136 6:33105210-33105232 AGGCTTAGTGGGTAGATGAGCGG + Intergenic
1006341324 6:33448732-33448754 AGCCTTGGTGGGGGGATGGCAGG - Intronic
1007217482 6:40251535-40251557 AGTCTTGGAGGGGAGATGGGCGG + Intergenic
1007513942 6:42396331-42396353 GGCCATGGTGGGAGGAGGGGTGG - Intronic
1007640558 6:43335876-43335898 AGCCTGGGTGGGTAGTGAGTAGG - Intronic
1008446768 6:51600714-51600736 AGCTTTTGTGGTTAGATGGGGGG - Intergenic
1009797626 6:68492152-68492174 AGCCTGGGAGGGTAGAGGGGAGG + Intergenic
1010516049 6:76773265-76773287 ATCCTGGGAGGGTAGAGGGGTGG + Intergenic
1012466208 6:99518869-99518891 AGGCTTGGTGGCTACTGGGGAGG + Intronic
1012860665 6:104555606-104555628 AGGCTTGAAGGATAGAGGGGAGG - Intergenic
1015787610 6:136933826-136933848 AGAATTGGTGGGTGGAGGGTTGG - Intergenic
1016719987 6:147285074-147285096 AGGCTTGGTGGTTTGAGGGGTGG + Intronic
1018226008 6:161629438-161629460 AGCCTGGGTTGGGAGAGGTGAGG - Intronic
1019033999 6:169039497-169039519 AGACTTGGAGGGTGGAAGGGTGG + Intergenic
1019420465 7:948310-948332 GGCCTCGGTGGGTACAGAGGTGG - Intronic
1019556153 7:1632574-1632596 AGCCTTGGTGTGTACAGGTGAGG - Intergenic
1020171880 7:5851351-5851373 AGCCTGGGTGGGTACAGGAGTGG + Intergenic
1020898978 7:13979280-13979302 AGGGTTGGTGGGTAGAGGACTGG - Intronic
1020905835 7:14062991-14063013 AGCCTGTGTGGGGTGAGGGGAGG - Intergenic
1022470595 7:30679861-30679883 AGCCTAGGTGGGAAGAGCAGAGG - Intronic
1023500392 7:40843734-40843756 TGGCTTGGTGGGAAGAGGAGTGG + Intronic
1023914455 7:44578267-44578289 AGAGGTTGTGGGTAGAGGGGAGG - Exonic
1024051533 7:45626869-45626891 AGCCTTGGGGTGCAGAGGGCTGG + Intronic
1024167610 7:46750304-46750326 TCCCTTGGTGGGTAGAGGCAAGG + Intronic
1024203770 7:47133550-47133572 AGCCTTTGTCGGTGGAGGAGGGG + Intergenic
1024578103 7:50781364-50781386 GGCCTGGGTGGGAACAGGGGAGG - Intronic
1025240563 7:57268570-57268592 AGTGTTGGTTGGTTGAGGGGTGG + Intergenic
1026768130 7:73173234-73173256 AGCCCTGGTGGGTAGGGTGCTGG + Intergenic
1026864649 7:73815997-73816019 AGCCTTGGGGGGAAGGGGGAGGG - Intronic
1027044595 7:74982944-74982966 AGCCCTGGTGGGTAGGGTGCTGG + Intronic
1027079043 7:75219416-75219438 AGCCCTGGTGGGTAGGGTGCTGG - Intergenic
1027123330 7:75537893-75537915 AGCCTAGGTACGAAGAGGGGTGG - Exonic
1027247910 7:76379789-76379811 AGCCTTGGTGGGAGGGGGCGGGG + Intergenic
1027704473 7:81511140-81511162 AGATTTGGTGGGTCCAGGGGCGG + Intergenic
1029086796 7:98018211-98018233 AGCCTGGGTGGGTAGAGGAGTGG - Intergenic
1029388275 7:100257985-100258007 AGCCCTGGTGGGTAGGGTGCTGG - Intronic
1030218434 7:107071584-107071606 AGCAGTGGTGGGAATAGGGGAGG + Intronic
1030529802 7:110698509-110698531 GGCAGTGGTAGGTAGAGGGGAGG - Intronic
1032553690 7:132809515-132809537 AGCTTTGGTAGGTGGAGGAGAGG - Intronic
1033044248 7:137947116-137947138 GTCCTTAGTGGGTAGAGTGGAGG - Intronic
1033150067 7:138906646-138906668 AGACTTGGGGGGAAGAGTGGCGG + Intronic
1034497481 7:151431358-151431380 ACCCTTGAGGGGCAGAGGGGAGG - Intronic
1036936152 8:13004358-13004380 AGCCTGGGTTGGGAGCGGGGTGG - Intronic
1037904132 8:22705379-22705401 AGTTTTGGGGGGTAAAGGGGAGG - Intergenic
1039685300 8:39795286-39795308 GGCCATGATGGGAAGAGGGGTGG + Intronic
1040967866 8:53102152-53102174 AGATATGGTGGGTAGAGAGGTGG - Intergenic
1041779648 8:61563765-61563787 AGCCTAGGTGGGCAGATAGGGGG - Intronic
1042855014 8:73257976-73257998 AGATTTGGGGGGTAGAAGGGTGG + Intronic
1043362618 8:79492949-79492971 AGCCTTGGTGAATAGGGGAGTGG - Intergenic
1045377593 8:101590619-101590641 GGGCTTGGTGGGAAGAGGGACGG + Intronic
1047529919 8:125665244-125665266 AGCTTTGGGGAGCAGAGGGGTGG - Intergenic
1047591321 8:126330197-126330219 AGCCTTGGTGGGGTCGGGGGTGG + Intergenic
1048464759 8:134656132-134656154 AGGCTGGGTGGGCAGAGGGAGGG + Intronic
1049375071 8:142285470-142285492 TGCATGGGTGGGTAGATGGGTGG + Intronic
1049979648 9:892430-892452 AGCCTGGGTGTGTAGAGCAGAGG - Intronic
1051108074 9:13603572-13603594 AGCCATGGTAGGTAGGGGTGAGG + Intergenic
1052449353 9:28607785-28607807 ACTATGGGTGGGTAGAGGGGTGG + Intronic
1053568962 9:39284395-39284417 ATCCATGCTGGGTAGTGGGGAGG - Intronic
1053834928 9:42125430-42125452 ATCCATGCTGGGTAGTGGGGAGG - Intronic
1054090591 9:60843362-60843384 ATCCATGCTGGGTAGTGGGGAGG - Intergenic
1054112002 9:61118919-61118941 ATCCATGCTGGGTAGTGGGGAGG - Intergenic
1054157514 9:61650985-61651007 AGGCGTGGTGGGGAGGGGGGCGG - Intergenic
1054477288 9:65581990-65582012 AGGCGTGGTGGGGAGGGGGGCGG - Intergenic
1054595610 9:67062099-67062121 ATCCATGCTGGGTAGTGGGGAGG + Intergenic
1055497362 9:76868825-76868847 ATCCTTGGGGGGTGGGGGGGGGG + Intronic
1055629706 9:78211288-78211310 AGCCTTGATGGGCAGATGGAGGG + Intergenic
1055967408 9:81879072-81879094 AGGCTTGGTGGGGAGTGGGAGGG + Intergenic
1056467683 9:86874124-86874146 AGCCTTGGTAGAGAGAGGTGGGG - Intergenic
1056999706 9:91496504-91496526 AGCCTTGGTAGGGAGAGGCTGGG + Intergenic
1058676299 9:107403100-107403122 AGCCTTTGTGGGAAGAGAAGGGG + Intergenic
1058826478 9:108779603-108779625 AGCCTGAGTGGGCAGAGGAGTGG + Intergenic
1058830953 9:108815943-108815965 TGTCTTGGAGGGTAGAGGGATGG - Intergenic
1059210192 9:112507087-112507109 AGTATTTGTGGGTAGAGGGAAGG + Intronic
1061146955 9:128805689-128805711 AGCCTTGCCTGGTAAAGGGGCGG - Intronic
1061398709 9:130357011-130357033 AGCATGGGTGGATAGAAGGGTGG + Intronic
1061398736 9:130357127-130357149 AGCATGGGTGGATAGAAGGGTGG + Intronic
1061515910 9:131090366-131090388 AGCCTGGGCAGGTAGAGTGGGGG + Intronic
1061612949 9:131760607-131760629 TGCCTTGGTGGGTGGGGGAGGGG - Intergenic
1061792217 9:133064768-133064790 TCCCTTGGGGAGTAGAGGGGAGG - Intronic
1061817456 9:133205578-133205600 ATCCTTGGTGGGTGGATGGTGGG + Exonic
1061922003 9:133787609-133787631 AGCCCTGGTGGGGTGGGGGGCGG - Intronic
1061964020 9:134003229-134003251 TGCGTTGGTGGGTGGATGGGTGG - Intergenic
1062464814 9:136676299-136676321 AGGCTGGGCAGGTAGAGGGGTGG - Intronic
1062530042 9:136995755-136995777 CGCCTGGGTGGGTGGAGCGGGGG + Exonic
1187726024 X:22203061-22203083 AGACTTGTTGGGTAAAGGTGGGG + Intronic
1188120475 X:26299953-26299975 AGGCTGGGTGGGAAGTGGGGAGG - Intergenic
1189232419 X:39462884-39462906 TGCCTTGATGGGCAGAGGGTAGG - Intergenic
1190017727 X:46842262-46842284 GGCTGTGGTGGGTAGTGGGGAGG - Intronic
1190483794 X:50904130-50904152 AGCCCTGTTGGGTAGAGGGATGG + Intergenic
1190887167 X:54540253-54540275 TGCCTTGGTGGGGAGAGAGAGGG + Intronic
1192206520 X:69100378-69100400 AGCCTGGGTGGGTATAGGGATGG - Intergenic
1192358248 X:70423169-70423191 AGCCCGGGTGGGAAGATGGGAGG - Exonic
1192424062 X:71060189-71060211 AGGTTTGGTGGCTTGAGGGGTGG - Exonic
1193484726 X:82072537-82072559 AGCATTGGAGGGTGGAGGGCAGG - Intergenic
1195705844 X:107737503-107737525 ACCCATGGTGTGTAGTGGGGAGG - Intronic
1195867595 X:109450026-109450048 AGCCGTGGTGGGCAGAGAGAGGG + Intronic
1196379560 X:115075053-115075075 ACCCTGGGTGGGTAGTGGCGGGG - Intergenic
1197990254 X:132309916-132309938 AGAGTTGGTGGGATGAGGGGTGG + Intergenic
1198377800 X:136056411-136056433 TGCCTTTGTAGGTAAAGGGGAGG - Intergenic
1198443453 X:136687663-136687685 AGCATTGGTGTGTAGGTGGGGGG - Intronic
1202042278 Y:20697903-20697925 ATGCTTGGTGGGTTGGGGGGTGG + Intergenic