ID: 1148722299

View in Genome Browser
Species Human (GRCh38)
Location 17:49763053-49763075
Sequence TTGGTGGGTAGAGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4192
Summary {0: 1, 1: 2, 2: 40, 3: 497, 4: 3652}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722282_1148722299 19 Left 1148722282 17:49763011-49763033 CCCCACTGCCACGTTGGCTGCAA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652
1148722291_1148722299 -8 Left 1148722291 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652
1148722285_1148722299 11 Left 1148722285 17:49763019-49763041 CCACGTTGGCTGCAATGCCCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652
1148722289_1148722299 -7 Left 1148722289 17:49763037-49763059 CCCGGACAAAACAGCCTTGGTGG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652
1148722288_1148722299 -6 Left 1148722288 17:49763036-49763058 CCCCGGACAAAACAGCCTTGGTG 0: 1
1: 0
2: 1
3: 18
4: 249
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652
1148722281_1148722299 24 Left 1148722281 17:49763006-49763028 CCTCACCCCACTGCCACGTTGGC 0: 1
1: 0
2: 1
3: 21
4: 258
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652
1148722283_1148722299 18 Left 1148722283 17:49763012-49763034 CCCACTGCCACGTTGGCTGCAAT 0: 1
1: 0
2: 1
3: 3
4: 84
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652
1148722279_1148722299 25 Left 1148722279 17:49763005-49763027 CCCTCACCCCACTGCCACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 180
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652
1148722284_1148722299 17 Left 1148722284 17:49763013-49763035 CCACTGCCACGTTGGCTGCAATG 0: 1
1: 0
2: 2
3: 16
4: 161
Right 1148722299 17:49763053-49763075 TTGGTGGGTAGAGGGGTGGAGGG 0: 1
1: 2
2: 40
3: 497
4: 3652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722299 Original CRISPR TTGGTGGGTAGAGGGGTGGA GGG Intronic
Too many off-targets to display for this crispr