ID: 1148722448

View in Genome Browser
Species Human (GRCh38)
Location 17:49763788-49763810
Sequence AAGTGTGAGGGGAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 655}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148722448_1148722453 -2 Left 1148722448 17:49763788-49763810 CCATCCACTTTCCCCTCACACTT 0: 1
1: 0
2: 2
3: 53
4: 655
Right 1148722453 17:49763809-49763831 TTCTCCCCGTCCCCCTCCCGCGG 0: 1
1: 0
2: 1
3: 33
4: 301
1148722448_1148722463 23 Left 1148722448 17:49763788-49763810 CCATCCACTTTCCCCTCACACTT 0: 1
1: 0
2: 2
3: 53
4: 655
Right 1148722463 17:49763834-49763856 ACGCGCCCCCCCTCCCCCAATGG 0: 1
1: 0
2: 2
3: 9
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148722448 Original CRISPR AAGTGTGAGGGGAAAGTGGA TGG (reversed) Intronic
900088227 1:908678-908700 AGGTGGGAGGGGAGAGGGGAGGG + Intergenic
900867761 1:5280637-5280659 AAGTGTGTGGGGAAAGTAGTGGG - Intergenic
900977601 1:6026968-6026990 AAGGGGGAGGGGAGAGAGGAGGG - Intronic
901325598 1:8363460-8363482 AAGGGGCAGAGGAAAGTGGATGG + Intronic
901507087 1:9691592-9691614 AAGTGTGTGGGGGAAGGGAAAGG + Intronic
902408583 1:16199837-16199859 AAGTAGGGAGGGAAAGTGGAGGG - Intronic
902672958 1:17987753-17987775 AGGTTTGAGGAGAAAGTTGAAGG - Intergenic
902777321 1:18683009-18683031 ACCTGTGTGGGGGAAGTGGATGG + Intronic
904024211 1:27492007-27492029 ATGGGTGAGGGAAGAGTGGAGGG - Intergenic
904044881 1:27603167-27603189 AAGGGGGAGGGGGAGGTGGACGG - Intronic
904464962 1:30702159-30702181 ATGAGTGATGGGAAAGTGGAGGG - Intergenic
904901792 1:33863457-33863479 AAATGTGAGGCGAAAGAGGGGGG - Exonic
905010323 1:34742647-34742669 AAGGCTCAGGGGAGAGTGGAAGG + Intronic
905330847 1:37195648-37195670 AAGAGAGAGGGGAAAGTGGGAGG - Intergenic
905787482 1:40769898-40769920 TACTGTGAGGGGAAAGCAGAGGG - Intronic
906144392 1:43551260-43551282 AAGTGTGGGGGAAGAGTGCACGG + Intronic
906552445 1:46676635-46676657 AGGTGTGGGGTGAGAGTGGATGG + Exonic
907651155 1:56296067-56296089 ATGTGTGAATGGAGAGTGGATGG - Intergenic
907859533 1:58338314-58338336 AAGAGTGAGGTGGAAGTGGGAGG - Intronic
907949551 1:59168974-59168996 GGGGGTGAGGGGAAAGGGGAGGG + Intergenic
908189236 1:61684366-61684388 AAGTGGGAAGGGAAACTGGTAGG - Intronic
908257314 1:62313699-62313721 GAGGGTGAGGGGCAAGGGGAGGG + Intronic
908438315 1:64128800-64128822 AAGTGTCGGGGGGAAGTGGCAGG + Intronic
908943790 1:69469394-69469416 AAGTGAGAAGTGAAAGTAGAAGG - Intergenic
909210937 1:72822408-72822430 AAATGTGAGGAGAAATTGGAAGG + Intergenic
909492645 1:76242596-76242618 CAGGGTGAGGGGAAAGGGGAGGG - Intronic
910406271 1:86893857-86893879 AAATGGGAGTGGGAAGTGGAGGG + Intronic
910969117 1:92836689-92836711 AAGTGCATGGGGAAAGAGGATGG - Intronic
912800599 1:112717470-112717492 AAGTGAGAGAGAAAAGGGGATGG + Intergenic
913078004 1:115357669-115357691 AAGTGGATGGGGAAAGTGGGAGG + Intergenic
913336596 1:117714213-117714235 AAGTGTGAGGCCCATGTGGAAGG + Intergenic
913425773 1:118727403-118727425 GGGTGTGTGGGGAAAGGGGAGGG + Intergenic
914925508 1:151882998-151883020 AAAGGTGAAGGGAAAGGGGAAGG + Intronic
915816603 1:158973715-158973737 AAGTGTCAGAAGAAAGAGGAGGG - Exonic
916266262 1:162892509-162892531 GAGTGTGAAGGGGAAGGGGATGG - Intergenic
916479563 1:165202682-165202704 AAGGCTGAGGGGATAGAGGAGGG - Exonic
916572077 1:166036818-166036840 AATTGCGAGGGGTAAGTGTAAGG - Intergenic
916821038 1:168399009-168399031 GAGTGGGATGGGAAGGTGGATGG + Intergenic
917403319 1:174676844-174676866 AATTATGAGAGGAAAGAGGAAGG - Intronic
917592098 1:176486913-176486935 ATGTGAGAGGGGGAAGTGGGTGG + Intronic
917954897 1:180085097-180085119 AAGGGAAAGGGGAAAGGGGAAGG - Intronic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
918957023 1:191221249-191221271 AAATGGGAGGGGAAAGAGTAAGG - Intergenic
919691383 1:200531356-200531378 AAGAGGGAGGGGAAAGGGGCAGG + Intergenic
919705409 1:200670283-200670305 AAGTGTGAGTGTAAAAGGGAGGG + Intergenic
920279740 1:204833920-204833942 AAATGTGAGAGGATAGTGAAAGG + Intronic
920386866 1:205575713-205575735 AAGTGGGAGAGGGAAGAGGAAGG - Intronic
920859901 1:209697290-209697312 GAGTGTGTGGGGAGAGGGGAGGG - Intronic
920871317 1:209797501-209797523 AAGTTTGAGGGGATAGGGTAAGG - Intronic
920910079 1:210208239-210208261 GAGTGTGGGAGGAAAATGGAGGG + Intergenic
921232011 1:213082522-213082544 AAGTGTTACTGGAAACTGGAGGG + Intronic
921297678 1:213720003-213720025 AAAAGTGTGGGGAAAGAGGAAGG - Intergenic
922579420 1:226685966-226685988 AAGAGTGAGGGAGAAGAGGAGGG + Intronic
922613324 1:226945758-226945780 AAGACTGAGGGAAAAGAGGAGGG - Intronic
922702911 1:227772102-227772124 AAGTGTGCGGGGCAAGTGCTGGG + Intronic
923265420 1:232309036-232309058 CAGTGTGGTGGGAAAGGGGAGGG - Intergenic
923295203 1:232587877-232587899 AAGAGTGAGAGCCAAGTGGAAGG - Intergenic
923547212 1:234931583-234931605 GAGTGTGTGGGGGGAGTGGAAGG - Intergenic
924020260 1:239773665-239773687 AAGTGTGAGGGGCCAATGGAAGG - Intronic
924130620 1:240903815-240903837 AAGTGAGGTGGGAAAGTGCAAGG - Intronic
924948148 1:248859382-248859404 AACTGTGAGGGGGAAATCGAAGG - Intergenic
1062821491 10:537563-537585 AAGTGTGCGGGGGAGGGGGACGG - Intronic
1063175749 10:3549417-3549439 AACCGTGAGGAGAAGGTGGATGG + Intergenic
1064750800 10:18526453-18526475 TATTGTGAGGGGGCAGTGGAGGG + Intronic
1065949750 10:30641257-30641279 CAGTGTGACGGGAATCTGGAGGG - Intergenic
1067360919 10:45577574-45577596 TCGTGTGATGGAAAAGTGGAAGG - Intronic
1067502742 10:46820517-46820539 AAGAGAGAGGGGAAGGGGGAAGG + Intergenic
1067591848 10:47519496-47519518 AAGAGAGAGGGGAAGGGGGAAGG - Intronic
1067638963 10:48027569-48027591 AAGAGAGAGGGGAAGGGGGAAGG - Intergenic
1069058724 10:63871677-63871699 AAGAGTGAGAGGAAAGAGGATGG + Intergenic
1069111454 10:64452646-64452668 AAATTTGAGGAGAAAGTGAAGGG - Intergenic
1069249945 10:66255551-66255573 GAGTGTGAGAGGCAAATGGAAGG - Intronic
1069385921 10:67883641-67883663 CAGGGAGAGAGGAAAGTGGAAGG + Intergenic
1070932407 10:80270718-80270740 CAGTGTTAGGGAAATGTGGACGG - Intergenic
1072234053 10:93438184-93438206 GAGTGTGGGGGGTCAGTGGATGG - Intronic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1072522171 10:96238394-96238416 ATGTGTGGGGGGAAAATGGCTGG + Intronic
1073592128 10:104767624-104767646 AAGTGGGAGGGGAAGGGGGAAGG - Intronic
1073592149 10:104767678-104767700 AAGTGGGAGGGGAAGGGGAAGGG - Intronic
1073966867 10:109000486-109000508 AGGAGTGGGGGGAAAGGGGAGGG - Intergenic
1074186606 10:111103692-111103714 AGGTGAAAGGGGAAATTGGAAGG + Intergenic
1074402550 10:113153876-113153898 AAGTATGAGAAGAAAGAGGAAGG - Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1075308903 10:121394740-121394762 AATTTTGAGAGGAAAATGGAGGG - Intergenic
1075819906 10:125298030-125298052 AGGTGGGAGGGGCATGTGGAAGG + Intergenic
1076262743 10:129080732-129080754 AAATGTTAGAGGAAAATGGACGG + Intergenic
1077177732 11:1198211-1198233 GAGGGTGAGGGGAGAGTGGGCGG + Intronic
1077388413 11:2286927-2286949 AAGTGTTAAAGGAAAGGGGAAGG - Intergenic
1077696073 11:4393697-4393719 AAGTCTGAGAGGAAAGGGGAGGG + Intergenic
1078091989 11:8269572-8269594 CAGTGAGAGGGCAAAGTGGGTGG - Intergenic
1078526210 11:12103520-12103542 AAGTGTGATGGAGAAGTGGCAGG + Intronic
1078527419 11:12111176-12111198 AAGAGGGAGGGGACAGGGGAGGG - Intronic
1078754001 11:14191443-14191465 AAGTGTGTGGGGAAGGAAGAAGG - Intronic
1079277703 11:19057050-19057072 CAATGTGAGGGCATAGTGGAGGG + Intronic
1079289920 11:19178785-19178807 AAGTGTGAGAGGAAGGAGAAGGG + Intergenic
1080144825 11:28968693-28968715 AAGAGTGAGGGGAAACAGGAAGG + Intergenic
1080224987 11:29950208-29950230 AAGTGTGGGGAGGAAGTGTATGG - Intergenic
1080418992 11:32093671-32093693 AAGTGAGAGGTGAGAATGGAGGG + Intronic
1080435875 11:32243475-32243497 AAGTGTGTGGGGGAAGGGGCGGG + Intergenic
1080587836 11:33697479-33697501 AGGAGTGAGGGGAGAGTGGTAGG - Intergenic
1081245338 11:40759325-40759347 ATGTGTGAAGGGAAAGTAAATGG - Intronic
1081406240 11:42701785-42701807 AAGTGTGTGATGAAAATGGAAGG + Intergenic
1081758395 11:45560494-45560516 AAGAGAGAGAGGAAAGGGGATGG - Intergenic
1081780016 11:45703749-45703771 AAGTGTGTGGGAAATCTGGAAGG + Intergenic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1083015026 11:59444234-59444256 AAGGGTGAGAGGAATCTGGAGGG - Intergenic
1083185236 11:61013808-61013830 AAGTGTTGGGGGAATGAGGAGGG + Intronic
1083349789 11:62019334-62019356 AAGTGTGAGGGGAAACATGAGGG + Intergenic
1084389514 11:68865893-68865915 AGGAGGGAGGGGAAAGGGGAGGG - Intergenic
1084398625 11:68931090-68931112 GAGTGGAAGGGGACAGTGGAAGG - Intronic
1084480826 11:69419073-69419095 AAGTGTGCGGGGGCAGTGGAGGG + Intergenic
1084569943 11:69953296-69953318 TAGGGTGAGGGAAATGTGGATGG + Intergenic
1084600319 11:70141640-70141662 AGGTGTGAGCGGAGAGGGGAGGG + Intronic
1085429700 11:76437419-76437441 AAGTGTGAGGGGCAAGTATTAGG - Intergenic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1086745012 11:90414190-90414212 CAGGGTGAGGGGAGAGGGGAGGG - Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087183964 11:95166819-95166841 AAATGTGAAGAGAAAGAGGAAGG + Exonic
1087487170 11:98770779-98770801 AAGAGGGAGGGGAAGGGGGAGGG + Intergenic
1087528811 11:99353042-99353064 AAGTGGCAGGGGCAAGTGGCAGG - Intronic
1087777207 11:102267607-102267629 AAATGTGGGGGGAAAAGGGATGG + Intergenic
1088159802 11:106855262-106855284 ATCTGTGGTGGGAAAGTGGATGG + Intronic
1088232706 11:107689021-107689043 AAGTGGGAGGAGAAGCTGGAAGG - Intergenic
1088659279 11:112029437-112029459 AAGTTGGAAGGGAAAGGGGAAGG + Intronic
1088976534 11:114821357-114821379 AAGAGAGAGTGGAAAGGGGAGGG - Intergenic
1089249253 11:117145454-117145476 AAAGGTGTGGAGAAAGTGGAAGG + Intronic
1089259206 11:117211484-117211506 AAGAGAGTGGGGAAAGTGGAAGG - Intronic
1089672972 11:120069260-120069282 AAGGGTGAAGGGGAAGAGGAGGG - Intergenic
1089849254 11:121482231-121482253 AAGAGCAAGGGGAAACTGGAGGG + Intronic
1090453819 11:126829849-126829871 AAGTGCGACGGGAATGTAGAGGG + Intronic
1090744196 11:129693657-129693679 AAGGGGGAGGGGAAAGGGAAGGG + Intergenic
1090776124 11:129967747-129967769 AAGAGTGAGGGGAATTAGGAAGG + Intronic
1092322095 12:7487082-7487104 GAGAGAGAGGGGAAGGTGGATGG + Intronic
1092322808 12:7496327-7496349 ATGGGTGGGGGGAAAGGGGAGGG + Intronic
1092499737 12:9033492-9033514 AAGTGAGAGGGGAAACAAGAGGG + Intergenic
1092961454 12:13600212-13600234 GAGTATGAGGGGAAAGAGGAAGG - Intronic
1093269141 12:17037180-17037202 AACTATGAAGGGAAAGAGGAAGG - Intergenic
1093757784 12:22871787-22871809 AAGTATGAGGGAAAAGATGATGG - Intergenic
1093844452 12:23951341-23951363 AATTGGGAGGGGAAGTTGGAAGG - Intergenic
1094218851 12:27972358-27972380 AAGTGTGTGGGGAAAAAGAAAGG - Intronic
1094225730 12:28043802-28043824 ACGGGTGGGGGGAAAGGGGAGGG - Intergenic
1095376418 12:41534437-41534459 AGGAGTGAGGGGAAGGGGGAAGG - Intronic
1095460407 12:42437844-42437866 AGTTGCCAGGGGAAAGTGGAAGG - Intronic
1095611137 12:44129276-44129298 AAAACTGTGGGGAAAGTGGATGG - Intronic
1095895803 12:47279494-47279516 ATGTGTGGGGGGACAGAGGAGGG - Intergenic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096489450 12:52005970-52005992 AAGTGAGAGGAGGAAGTGGAAGG - Intergenic
1097013480 12:55969334-55969356 CAGTGGGAGGGGAAAGATGATGG + Intronic
1097250861 12:57631776-57631798 AAGTGGGAGGTGGAAGTGGGAGG - Intronic
1097622472 12:61957403-61957425 CAGAGTGAGGGGTCAGTGGATGG + Intronic
1098010480 12:66045463-66045485 AAGGGTGAGGGAAAAGTCGCCGG + Intergenic
1098224936 12:68311627-68311649 AGGAGTGAGGGGAAAGTTGTTGG - Intronic
1099052176 12:77793463-77793485 GGGTGTGGGGGGCAAGTGGAGGG - Intergenic
1099212416 12:79808248-79808270 CAGAGTAAGGGGAAAGTGGGAGG - Intronic
1099328513 12:81251210-81251232 AAGGGTTAGGGGAAAGGGAAGGG + Intronic
1099348672 12:81537048-81537070 AAGTCTGAGTGGAAAGCAGAAGG + Intronic
1099366335 12:81769116-81769138 GAGTGGGAGGGGAAAGAGGGTGG + Intergenic
1099491110 12:83289430-83289452 AAATGTGAAGGGAAAGGAGAAGG + Intergenic
1100250370 12:92815365-92815387 AAGGGGGAGGGGAATGAGGAGGG - Intronic
1101641161 12:106586586-106586608 AGATGGGAGCGGAAAGTGGATGG - Intronic
1101858310 12:108462719-108462741 AAGTGGGAGGGGAATGGGGAGGG - Intergenic
1102167931 12:110820950-110820972 AAGAGGGAGGGGAGAGGGGAGGG - Intergenic
1102556049 12:113727295-113727317 AAGAGAGAGAGGAAAGAGGAAGG - Intergenic
1102569084 12:113816401-113816423 AACTGTGAGAGGTAAGTTGATGG - Intergenic
1102657207 12:114492075-114492097 AAGAGTGAGGAGAGAATGGATGG + Intergenic
1103425494 12:120830360-120830382 AGGGGTGAGGGGGAAGGGGAGGG + Intronic
1103425510 12:120830389-120830411 AAGGGGGAGGGGGAAGGGGAGGG + Intronic
1103425525 12:120830417-120830439 AAGGGGGAGGGGGAAGGGGAGGG + Intronic
1103425540 12:120830445-120830467 AAGGGGGAGGGGGAAGGGGAGGG + Intronic
1103425556 12:120830474-120830496 AAGGGGGAGGGGGAAGGGGAGGG + Intronic
1103542119 12:121673277-121673299 AGGTGTGAGTGGAAAGGGGAGGG - Intergenic
1103674357 12:122644039-122644061 AAGTGTGATGGGGGAGTGGCTGG + Intergenic
1104178000 12:126351487-126351509 AGGTGTGAGGGGTAGGGGGATGG - Intergenic
1104224307 12:126816365-126816387 AAGGGTGAGGGGATGGGGGAGGG - Intergenic
1104337237 12:127910812-127910834 AAGTGTGAGGTAAGAGAGGAAGG - Intergenic
1106269283 13:28138483-28138505 AAGGGGGAGGGGAGAGGGGAGGG - Intergenic
1106511007 13:30412551-30412573 AACAGTGAGGGGAAAGAGGTAGG + Intergenic
1107409741 13:40147520-40147542 GCGGGTGAGGGGAAAGGGGAGGG + Intergenic
1108213970 13:48165500-48165522 AGGTGGGAGGGCCAAGTGGACGG + Intergenic
1108404418 13:50085407-50085429 AACTGTGAGTGGAAAGGGGTGGG - Intronic
1108676788 13:52743917-52743939 AAGGGTGTGGGAAATGTGGAGGG + Intergenic
1109162939 13:58998969-58998991 ATATGTGAAGGGAAAGAGGAGGG + Intergenic
1111033686 13:82641467-82641489 AAGCAAGATGGGAAAGTGGAAGG - Intergenic
1111999720 13:95198958-95198980 GAGGGTGAGGGGCAAGGGGAAGG + Intronic
1112187173 13:97138493-97138515 TAGTTTGATGGGAGAGTGGAGGG - Intergenic
1112734641 13:102402329-102402351 AAGAGTGAGAGGAAGGAGGAAGG - Intergenic
1113572462 13:111368399-111368421 AAGTGTGTGGGGTAGGGGGACGG + Intergenic
1113871729 13:113564086-113564108 AAGAGTTTGGGGCAAGTGGATGG - Intergenic
1113939792 13:114012656-114012678 CAGTGTGTGGGGAGTGTGGAAGG - Intronic
1113975554 13:114225398-114225420 AAGTGAGGGGGGAAAGGGGAGGG + Intergenic
1114135258 14:19840864-19840886 AAGAGTGAGTGGAAAGGGCAGGG + Intergenic
1114148297 14:20005064-20005086 GGGGGTGAGGGGAAAGGGGAAGG - Intergenic
1114220639 14:20693388-20693410 AAGTGTGAGGTTAATGAGGAAGG + Intronic
1114245116 14:20905581-20905603 AAGAGTAAGGGAAGAGTGGAAGG + Intergenic
1114350741 14:21848197-21848219 AAGTGAGGGGGGAAAATGGTTGG - Intergenic
1114525823 14:23366319-23366341 AGGAGGGAGGGGAAAGGGGAGGG + Intergenic
1115193262 14:30769686-30769708 ATATGTGTGGGGAGAGTGGAGGG - Intergenic
1115646429 14:35371452-35371474 AAGTGTGTGCTGAATGTGGATGG + Intergenic
1116582349 14:46658648-46658670 AAGTGGGAGTGCAAAATGGAGGG + Intergenic
1117285114 14:54279288-54279310 AAGTATGAGGGGAAAGGGGCTGG - Intergenic
1117749722 14:58908625-58908647 AAGGGTGAGGGGATGGAGGAGGG + Intergenic
1118012860 14:61627840-61627862 AAGTGTAAGGGTAGAGTTGAGGG - Intronic
1118039430 14:61901039-61901061 AAGTCAGAAGGGAAATTGGAAGG - Intergenic
1118334406 14:64840695-64840717 AAGTGTGTGGGGATGGTGAAGGG - Intronic
1118850042 14:69576162-69576184 GACTGTGAGGAGAAAGTGAAGGG + Intergenic
1118882714 14:69842739-69842761 GAATGGGAGGGGAAAGCGGAAGG + Intergenic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1120927228 14:89809919-89809941 AATTGTGGGGGGAAATTGTAGGG - Intronic
1121590391 14:95101901-95101923 TAGTGTGATGGGGAAGGGGAAGG + Intronic
1121940558 14:98066413-98066435 AAGTGGAAGGTGACAGTGGATGG + Intergenic
1121990604 14:98553295-98553317 AAGGGAGAGAGGAAAATGGATGG - Intergenic
1122723873 14:103737723-103737745 AAGTGTGAGGAGATGGAGGAAGG - Exonic
1122872940 14:104649680-104649702 AATTCTGTGGGCAAAGTGGAGGG - Intergenic
1124363098 15:29053327-29053349 CAGTTTGAGGGGGAAGAGGAGGG + Intronic
1124719372 15:32098292-32098314 AAGGCTGTGGGGAAAGGGGAGGG + Intronic
1127168742 15:56276320-56276342 AGGTGTGGGGGGCAAGAGGAGGG - Intronic
1127531006 15:59843563-59843585 AAGTGTGTGGGGAGAGCGGTGGG + Intergenic
1128636471 15:69305639-69305661 GCGTGAGAGGGGAAAGTGGGTGG - Intronic
1129044983 15:72725989-72726011 GAGAGGGAGGGGAAAGGGGAAGG - Intronic
1130052540 15:80495800-80495822 CAAGGTGTGGGGAAAGTGGAAGG - Intronic
1130334651 15:82948663-82948685 AAGTCTGAAAGGAAAGAGGAAGG + Intronic
1131251949 15:90836796-90836818 CAGAGTGAGGGCACAGTGGACGG - Intergenic
1131410037 15:92199989-92200011 GAGAATGAGGGGAAAGGGGAGGG + Intergenic
1131453717 15:92566822-92566844 TGGGGTGAGGGGAAAGGGGAGGG - Intergenic
1132014286 15:98302052-98302074 AACTGTGAGGGGAAAATGCAGGG - Intergenic
1132158547 15:99514825-99514847 AAGGGTGAGGGGAGAACGGAGGG - Intergenic
1132324644 15:100958721-100958743 TATTGTGAGGGTCAAGTGGATGG - Intronic
1132854388 16:2038413-2038435 AAGGGGGAGGGGAAGGGGGAGGG - Exonic
1133333141 16:4988588-4988610 AGGAGGGAGGGGAAAGAGGAGGG - Intronic
1133819538 16:9224284-9224306 AAGAGAGAGGGGAAAGGGGAAGG - Intergenic
1134373578 16:13649080-13649102 GGGGGTGAGGGGAAAGGGGAGGG - Intergenic
1134523202 16:14927816-14927838 AAGGGGGAGGGGAGAGGGGAGGG - Intronic
1136165007 16:28447963-28447985 AAGTGAGAGAGGAAGGGGGAGGG - Intergenic
1136197960 16:28667017-28667039 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136214305 16:28781194-28781216 AAGTGAGAGAGGAAGGGGGAGGG + Intergenic
1136259027 16:29061039-29061061 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1137560412 16:49498673-49498695 AAGTGTGGGAGGAAAGGGGAAGG - Intronic
1138730314 16:59186908-59186930 AAGTGGTATGGGAGAGTGGAGGG + Intergenic
1138942731 16:61809432-61809454 AAGGGTCAGGGGCAAGGGGAGGG + Intronic
1139117932 16:63979567-63979589 AAGGGTTGGGGGAAAGGGGAGGG - Intergenic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1140983339 16:80132873-80132895 AAGGGTGAGGTGGAGGTGGAAGG - Intergenic
1141125821 16:81400279-81400301 GAGTGTGTGGGGAAAGGGGTGGG - Intergenic
1141167281 16:81669078-81669100 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167311 16:81669216-81669238 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167321 16:81669264-81669286 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167374 16:81669492-81669514 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141186270 16:81789790-81789812 AAGTGGGAGGGAGAAGAGGAGGG - Intronic
1142869439 17:2810502-2810524 AAGGGTGGGGGGACAGGGGAGGG - Intronic
1143005160 17:3827070-3827092 AAGGGTAGGGGGAAAGGGGAAGG + Intronic
1143871315 17:9959030-9959052 AGGTGGGAGGGGCATGTGGATGG + Intronic
1143887493 17:10076086-10076108 AAGAGGGAAGGGAAAGTGGAGGG + Intronic
1143887538 17:10076204-10076226 AAGTGGGAGGGGGAGGGGGAGGG + Intronic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144190130 17:12837969-12837991 CAGGGTGATGGGAAAGCGGAGGG - Intronic
1144572225 17:16407361-16407383 AAGCGAGAGGGGAAAGAGCAGGG + Intergenic
1146131102 17:30276010-30276032 AAAGGTGAAGGGGAAGTGGAGGG - Intronic
1146296358 17:31653648-31653670 AGGGGAGAGGGGAGAGTGGAAGG - Intergenic
1146826864 17:36030671-36030693 GAGAGAGAGGGGAAAGGGGAAGG - Intergenic
1146986680 17:37226823-37226845 AAGTGGGAGGGGAAACAGGAAGG - Intronic
1147418414 17:40309773-40309795 AAGTGTGAGATGAACCTGGAAGG - Intronic
1147810119 17:43162844-43162866 GACTGTGAGGGGTACGTGGACGG - Intergenic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148722448 17:49763788-49763810 AAGTGTGAGGGGAAAGTGGATGG - Intronic
1148976281 17:51532692-51532714 AAATGTAATGGGAAAATGGAGGG - Intergenic
1149003897 17:51784342-51784364 AGGTGTGAGGGAAACATGGAAGG + Intronic
1149049528 17:52288509-52288531 AAGGTTAAAGGGAAAGTGGAAGG + Intergenic
1149195167 17:54110786-54110808 AAGAGAGAGGGGGAGGTGGAGGG + Intergenic
1149253836 17:54801650-54801672 AAGAGTGAGTGGAAATTGAAGGG + Intergenic
1149608215 17:57939796-57939818 AAGGGTTACTGGAAAGTGGACGG + Intronic
1150075865 17:62191662-62191684 AAGTGAGAGGGGGAAGTGACTGG - Intergenic
1150135037 17:62690816-62690838 AAGGCTCAGGGCAAAGTGGAGGG - Intronic
1150219479 17:63487936-63487958 AAGTGTGAGGGGAGGCTGGCCGG + Intronic
1150439408 17:65179189-65179211 AAGTGGGAGGGGAAAGAAAAAGG + Intronic
1150451324 17:65271244-65271266 AGGGGAGAGGGGAAAGAGGAGGG + Intergenic
1151081684 17:71336516-71336538 GGGTGTGAGGGGAAAGGGGATGG + Intergenic
1151507962 17:74541791-74541813 AAGGGTCAGGGGATGGTGGAGGG - Intronic
1151533920 17:74726474-74726496 ACGAATGAGGGGAACGTGGATGG + Intronic
1152075755 17:78158724-78158746 TAGTGTGAGGGGGAAGAGGAGGG - Intronic
1153360369 18:4188456-4188478 GGGTGTGAGGGGCAAGGGGAGGG - Intronic
1153748944 18:8209821-8209843 CAGGGTGAGGGGTAAGGGGAGGG + Intronic
1153761128 18:8333810-8333832 AAGTGCGAAGGGAAAGGGGAGGG - Intronic
1154459387 18:14564819-14564841 AAGAGTGAGTGGAAAGGGCAGGG + Intergenic
1154523931 18:15262306-15262328 AAGTGTGAAAGGAAAGTGCCAGG - Intergenic
1154980891 18:21501404-21501426 ATGGGTGAGGGGCAAGAGGAGGG - Intronic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155789358 18:29946165-29946187 TAGGCTGAGGGGAAAGAGGAAGG + Intergenic
1155812542 18:30255670-30255692 AAGTTTGGGGGGCAAGGGGAGGG + Intergenic
1156336791 18:36179722-36179744 AAGTGAGAGTGGGAAGTGAAAGG - Intronic
1156434024 18:37106907-37106929 TAGTGTAAGGGGTAAGTGGCAGG - Intronic
1157271896 18:46282604-46282626 ACGTTGGAGGGGAATGTGGAGGG + Intergenic
1157402404 18:47399592-47399614 AAGTGGGAGTGGCCAGTGGAAGG + Intergenic
1157507257 18:48236974-48236996 AAATGGGAGGGGAAAGGGCAAGG + Intronic
1158155723 18:54423371-54423393 GAGTGTGAAGGGAAAAAGGAGGG + Intergenic
1158461091 18:57646244-57646266 AAGTGTTAGGGAAAAGGTGATGG - Intergenic
1159071245 18:63625994-63626016 AAGAGAGAGAGGAAAGTGGGAGG + Intergenic
1160514862 18:79472640-79472662 AAGTGTGTGGGGTGAGGGGAGGG - Intronic
1160618280 18:80150612-80150634 AAGTGTGAAGGGAAGCTGCAGGG + Intronic
1160912509 19:1481504-1481526 AAAAGCCAGGGGAAAGTGGAGGG - Exonic
1162876787 19:13626602-13626624 AAGGGGGAAGGGAAAGGGGAAGG + Intergenic
1163351107 19:16777311-16777333 AAAGGGGAGGGGAAAGAGGAGGG + Intronic
1164406899 19:27957248-27957270 AAGAGAGAGGGGAAGGGGGAAGG + Intergenic
1164541942 19:29128024-29128046 AAGAGCAAGGGGAAAGCGGAGGG + Intergenic
1164935854 19:32211015-32211037 AAATGAGAGGAGAAAGAGGATGG + Intergenic
1166257177 19:41614956-41614978 AAGGGGGAGGGGAAAAGGGAAGG + Intronic
1166690345 19:44818677-44818699 AGGAGTGAGGGGAGAGAGGAGGG - Intronic
1166923457 19:46249050-46249072 AAGGGTGAGGGTAGAGGGGAAGG + Intergenic
1167175313 19:47860617-47860639 AAGAGGGAGGGGAAAGTAGGGGG - Intergenic
1167270739 19:48504294-48504316 CAGCGTGAGGGTAAAGGGGAGGG - Intronic
1168521407 19:57053763-57053785 AAGTGTGACGGAAATGTTGAAGG - Intergenic
925076350 2:1019460-1019482 AGGTGTGCTGGGAATGTGGAGGG + Intronic
925397779 2:3548580-3548602 AACTGTGAAGGGAAATTGGTAGG - Intronic
925427292 2:3760678-3760700 GGGGGTGAGGGGAAAGGGGAGGG + Intronic
925427868 2:3765821-3765843 AAGTGTGAAGGGCAAGGGAAGGG + Intronic
925755531 2:7128342-7128364 AAAGGGGAGGGGAAAGGGGAGGG - Intergenic
925927587 2:8681672-8681694 AAGGGGGAGGGGAAGGAGGAGGG - Intronic
925927592 2:8681684-8681706 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
926476996 2:13336162-13336184 GAGAGTGCGGGGAAAGTGGTGGG + Intergenic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
927114248 2:19885909-19885931 GAGAGTGAGGGGAGAGAGGAAGG - Intergenic
927571855 2:24167040-24167062 AAGTGTGAGGGGAAGCTGTGCGG + Intronic
928112682 2:28523505-28523527 GAGTGTGAAGGGAAAGTGGCTGG + Intronic
928776107 2:34765582-34765604 GTGGGTGAGGGGAAAGAGGAGGG + Intergenic
928951583 2:36817856-36817878 GAGTTTGAGGGGAAAGGGCATGG - Intergenic
929228400 2:39534184-39534206 AAGTTTGAGGGGGAAGGAGAAGG - Intergenic
929600563 2:43201755-43201777 AAGTGTGAGGGGAGATGAGAGGG + Intergenic
929993692 2:46811806-46811828 AAGTGAGGGGGGCAAGGGGAAGG - Intergenic
930084012 2:47480098-47480120 AAGGGGGAAGGGAAAGGGGAAGG - Intronic
930084096 2:47480306-47480328 GAGGGGGAGGGGAAAGGGGAAGG - Intronic
931223981 2:60313408-60313430 AAGTGAGATGGGAAAGGGTAGGG - Intergenic
932033551 2:68215800-68215822 AAGATGGAGGGGAAAGTGGGTGG + Intronic
932424532 2:71620682-71620704 AAATGGGAGGGGAGAGTGGGAGG + Intronic
932695200 2:73950554-73950576 AAGTGGGATGGGAATGGGGAGGG - Intronic
933816591 2:86073563-86073585 AAGTTTGAGGGGAATGTGCAGGG - Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
934868987 2:97842555-97842577 CAGTGTTGGGGGAGAGTGGAGGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935009701 2:99121952-99121974 AAGTGTGAGATTTAAGTGGAGGG + Intronic
935129665 2:100252210-100252232 AAGTTTAAGGGTAAAGTGAACGG + Intergenic
935556578 2:104516385-104516407 AGATGTGACAGGAAAGTGGAAGG + Intergenic
936052634 2:109236415-109236437 AAGTTTGAGGAGAAAGAGAATGG - Intronic
937149159 2:119673990-119674012 AAGCCTGAGGGGAAGGTGGGAGG - Intergenic
937263161 2:120599239-120599261 AAGTGGGAAGGGGAAGTGGAAGG - Intergenic
937363606 2:121245511-121245533 AAGTGGGAGGGAGAAGTGGCTGG - Intronic
937552133 2:123107551-123107573 ATGGGGGAGGGAAAAGTGGAAGG - Intergenic
938899670 2:135789516-135789538 AAGGGTGAAGGGCAGGTGGAAGG - Intronic
938942714 2:136182855-136182877 AAGGGTTGGGGGAAAGAGGAGGG + Intergenic
939657632 2:144847721-144847743 GAGAGGGAGGGGAAAGAGGAGGG + Intergenic
939991254 2:148877740-148877762 AGGGGAGAGGGGAAAGGGGATGG - Intronic
940196911 2:151104857-151104879 AGGGGTGGGGGGAAAGGGGAGGG + Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940786376 2:157985667-157985689 AAAAATGAGGGGAAAGGGGATGG - Intronic
941415669 2:165217989-165218011 GGGAGTGTGGGGAAAGTGGAGGG - Intergenic
942084336 2:172429523-172429545 AAGTGTGAAGGGAAAGTACTGGG + Intronic
942809686 2:179983257-179983279 GAGGGTGAAGGGAGAGTGGAGGG - Intronic
943021690 2:182582106-182582128 AATTCTGAGGTGCAAGTGGATGG - Intergenic
943106563 2:183550980-183551002 GAGGGTGAGGGGATAGGGGAGGG + Intergenic
943799004 2:192034393-192034415 AGGAGTGATGGGAGAGTGGAAGG - Intronic
944932181 2:204530967-204530989 TAGAGTGAGGGAAAAGAGGATGG - Intergenic
945253754 2:207786899-207786921 AAGAGTCAAGGGAAAGTAGAAGG - Intergenic
945385232 2:209190436-209190458 AAGTGTTATGGGAATGTGGAAGG - Intergenic
945913513 2:215677534-215677556 AAGTGTTAAGGGAAATTAGAAGG + Intergenic
946011990 2:216572762-216572784 AACAGTGAGGGGAAAGAGCACGG - Intronic
946566766 2:220974138-220974160 AAGAAGGAGGGGAATGTGGAGGG + Intergenic
946716035 2:222556328-222556350 AAGCGTGAGGGGATGGTGGAGGG + Intronic
946960132 2:224976234-224976256 AGGGGTGGGGGGAAAGGGGAGGG + Intronic
947461927 2:230310875-230310897 ACGTGTGAGGGGAAAGGAGAAGG - Intronic
947471011 2:230401087-230401109 ACGTGTGAGGGGAAAGGAGAAGG - Intronic
947672006 2:231943374-231943396 AAGTGTAGGGGGAAATCGGAAGG + Intergenic
948498407 2:238370805-238370827 AAGAGAAAGGGGGAAGTGGAAGG + Intronic
1168787828 20:555274-555296 AAGTGTGTAGGGAAAATGAATGG + Intergenic
1169178360 20:3539746-3539768 AAGTGGGAGGGGGCGGTGGAGGG - Intronic
1169244114 20:4011809-4011831 AAGTATGAGTGGGAAATGGAAGG + Intronic
1169718677 20:8648182-8648204 AAGTGGGTGGAGGAAGTGGAGGG + Intronic
1170021024 20:11836975-11836997 AAGAGTGAGGGGGCAGTGGGTGG - Intergenic
1170290804 20:14766060-14766082 AAGTGTGAGGGCAATGTGAATGG - Intronic
1170510949 20:17076177-17076199 AGGTGTGAGGTGAGAGTGGTAGG + Intergenic
1170731608 20:18980871-18980893 GAGGGTGAGGGGCAAGGGGAGGG - Intergenic
1170738312 20:19029444-19029466 AGGGGTGGGGGGAAAGGGGAGGG + Intergenic
1170788920 20:19491734-19491756 GAGTGGGAGAGGAAAGAGGAAGG + Intronic
1170833346 20:19862236-19862258 AAGAGTGGAGGGACAGTGGATGG - Intergenic
1171266175 20:23773748-23773770 AAGTGTGTGGGGGAGGTGCATGG - Intergenic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1173127902 20:40357146-40357168 AAGTGGGAGAGGAAAGTGAGAGG - Intergenic
1173758876 20:45542452-45542474 AAGTATGAGGGGAATTAGGAGGG - Intronic
1174149717 20:48477610-48477632 GAGGGCGAGGGGAAAGAGGAAGG + Intergenic
1174707029 20:52667576-52667598 AAAAGTGAGGGGAAAGAAGAAGG - Intergenic
1174843651 20:53922435-53922457 AAATGAGAGGGGGAAGAGGAGGG - Intergenic
1174858001 20:54064988-54065010 AAATGTGATGGGAAAGTGCCTGG + Intronic
1175164409 20:57033187-57033209 AAGTGTGCGGGGAGAGGGGGTGG - Intergenic
1175531232 20:59675119-59675141 GAGGGAGAGGGGTAAGTGGAGGG - Intronic
1175531252 20:59675175-59675197 GAGGGAGAGGGGTAAGTGGAGGG - Intronic
1175533293 20:59689524-59689546 AGATGGGAGGGGACAGTGGATGG - Intronic
1175930304 20:62490683-62490705 AAGTGTGAGGGGTTGGGGGAGGG - Intergenic
1175990249 20:62785222-62785244 AAGGGTGAGGGGAATGGGGTGGG + Intergenic
1176306531 21:5126491-5126513 ATCTGTGATGGGAAAGTTGAGGG - Intronic
1176814757 21:13588514-13588536 AAGAGTGAGTGGAAAGGGCAGGG - Intergenic
1177046991 21:16183157-16183179 AAGTGGAAGGTAAAAGTGGAAGG - Intergenic
1177215933 21:18128577-18128599 AAATGTTATTGGAAAGTGGATGG + Intronic
1177758351 21:25373802-25373824 GAGGGGGAGGGGAAAGGGGAGGG - Intergenic
1177758365 21:25373829-25373851 GAGGGGGAGGGGAAAGGGGAGGG - Intergenic
1178194029 21:30321940-30321962 AATTGTGAGGACAAAGTGAATGG - Intergenic
1178580149 21:33831499-33831521 AAGTTTGAGGGGGAAGAGGGAGG + Intronic
1178926542 21:36780094-36780116 AATTGTGTGGGGTAGGTGGATGG - Intronic
1179046250 21:37847908-37847930 AAGAGTGATGGGAGAGGGGAGGG + Intronic
1179465293 21:41567793-41567815 AAGTGCCAGGAGGAAGTGGAAGG + Intergenic
1179850528 21:44135539-44135561 ATCTGTGATGGGAAAGTTGAGGG + Intronic
1180115099 21:45697988-45698010 TAGTGTGTAGGGAAGGTGGATGG - Intronic
1180941697 22:19663793-19663815 GGGGGTGAGGGGAAAGGGGATGG - Intergenic
1181166889 22:20988763-20988785 GAGTGTGAGGGAAGAGGGGAGGG - Intronic
1181418559 22:22779698-22779720 AAGAGGGAAGGGAAAGGGGAAGG + Intronic
1182830265 22:33299325-33299347 AAGAGGGAAGGGAAAGGGGAGGG + Intronic
1183419741 22:37704465-37704487 AAGGGGGAGGGGAAGGGGGAGGG + Intronic
1183468548 22:37993054-37993076 AAGAGAGTGGGGAAGGTGGAGGG + Intronic
1184100767 22:42340843-42340865 GAGGGGGAGGGGAAAGGGGAGGG + Intronic
1184295522 22:43521810-43521832 AAGGGGGAGGGGACAGGGGAGGG - Intergenic
1185029936 22:48436993-48437015 AAAAGTGAGGGGAAGGTAGATGG + Intergenic
950164026 3:10780150-10780172 AAGTGAGAGAGGAAGGAGGATGG - Intergenic
950236966 3:11330834-11330856 GAGTGGGATGGGAAAGGGGAGGG + Intronic
950518608 3:13483087-13483109 AAGGGCGGGGGGAAGGTGGAGGG + Intronic
950635519 3:14311686-14311708 AAGGGAGAGGGGAAAGAGGGAGG - Intergenic
951251606 3:20400425-20400447 AAGTGTGGGAGGAAAATGGTAGG + Intergenic
951548114 3:23849498-23849520 GAGGGTGAGGGGTAAGGGGAGGG - Intronic
951719118 3:25679580-25679602 AAGGGGGAGGGGAAAGGGGGAGG + Intergenic
951719135 3:25679618-25679640 GAGGGCGAGGGGAAAGGGGAAGG + Intergenic
951719144 3:25679637-25679659 AAGGGCGAGGGGAAAGGGGGAGG + Intergenic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952875948 3:37944596-37944618 AAGTGGGAAGGGTAAATGGAAGG - Intronic
953186366 3:40641845-40641867 AAGGGTGAGGGGATATGGGATGG + Intergenic
953673317 3:44980688-44980710 AAGCTTGTGGGGAAACTGGAAGG + Intronic
954088860 3:48269022-48269044 ATGTGTGTGGGGAATGTGGGCGG + Exonic
954088917 3:48269442-48269464 ATGTGTGTGGGGAATGTGGGCGG + Exonic
955483968 3:59417318-59417340 AAGTGTGAGGGTAGTGTAGAGGG - Intergenic
955517241 3:59738437-59738459 GAGTGGGGTGGGAAAGTGGAAGG - Intergenic
956474701 3:69607888-69607910 GAGAGGGAGGGGAAAGAGGATGG + Intergenic
956991562 3:74772349-74772371 AAGTGAGAGGGGACACTGGTAGG - Intergenic
957301831 3:78401662-78401684 ATGTGTGTGGGAAAAGTGAAGGG - Intergenic
957369067 3:79267501-79267523 AAGAGTGAGAGGATAGTGGTGGG + Intronic
957375546 3:79352633-79352655 GAGTGTGAGTAGAAAGGGGAAGG - Intronic
957705423 3:83774374-83774396 AGGTGTGAGGGACAAGGGGAGGG + Intergenic
957755660 3:84483081-84483103 GAGGCTGAGGGGAAAGAGGATGG + Intergenic
958417965 3:93898958-93898980 AAATGAGAAGGGAAAGAGGAAGG + Intronic
959771666 3:110106429-110106451 ATCTGTGAAGGAAAAGTGGAGGG + Intergenic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
960127750 3:114018943-114018965 AAGTGTGAGGGGAAAATCTGAGG - Intronic
960137935 3:114124400-114124422 AAGTTTGGGGTGCAAGTGGATGG + Intergenic
961524440 3:127487647-127487669 AGGTGTGAGGGGAGGGTGGGGGG - Intergenic
961925913 3:130480448-130480470 AATTCTATGGGGAAAGTGGAAGG + Intronic
962070419 3:132028177-132028199 AATTTTGAGGGAGAAGTGGAGGG - Intronic
962249149 3:133824399-133824421 ATGGGTGAGGGGAAAGTGAGGGG + Exonic
962477700 3:135770985-135771007 AAGTGGGAGAGGAAAGGGTAGGG - Intergenic
962888015 3:139645928-139645950 AAAAGTGAGAGGAAAGAGGAAGG + Intronic
962937335 3:140092931-140092953 AAGGATGAGGGGTGAGTGGATGG + Intronic
963529472 3:146455977-146455999 AAGTGAGAGGCAAAAATGGAAGG + Intronic
963938866 3:151081433-151081455 AAGTGGGAGGGGGAGGGGGAAGG - Intergenic
964379838 3:156087359-156087381 CAGTGTGAAGGAAAAGTAGAGGG - Intronic
964712663 3:159687741-159687763 GAGAGTGAGGGGCAAGGGGAGGG - Intronic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
965110084 3:164409829-164409851 AAGGGTGAGGGGCAAAGGGAGGG - Intergenic
965120414 3:164547481-164547503 AAGTGTATGTGGCAAGTGGAAGG + Intergenic
965558503 3:170040024-170040046 GAGGGTGGGGGGAAAGGGGAGGG + Intronic
965921830 3:173926766-173926788 GAGTGGGTGGGGAAAGTGCAGGG + Intronic
966069900 3:175863058-175863080 ATATGTTAGGGGAAAGGGGAGGG - Intergenic
966101728 3:176277556-176277578 GGGTGTGAGGGGCAAGGGGAGGG - Intergenic
966677666 3:182606745-182606767 AAATGTTAGGGGAAACTGGGTGG + Intergenic
966845264 3:184124026-184124048 AAGGGAGAGAGGAAAGTGTAGGG + Intergenic
966897655 3:184457729-184457751 AAGGGGAAGGGGAAATTGGAGGG + Intronic
967210240 3:187162101-187162123 AACGGGGAGAGGAAAGTGGATGG - Intronic
969703031 4:8778056-8778078 CAGTGTGATTGGAAAGTGAATGG + Intergenic
970454788 4:16212357-16212379 AAGTGTGAGGACACAGTGCAGGG - Intronic
970687464 4:18584930-18584952 AAGTGTGTGGGGGAAGTACATGG - Intergenic
970858562 4:20676104-20676126 GAGTGAGAGGAGAAAGAGGAGGG + Intergenic
970920470 4:21388662-21388684 GAGTGTTGGGGAAAAGTGGAGGG - Intronic
971586758 4:28414496-28414518 AAGGGGGAGGAGAAAGAGGAAGG - Intergenic
972924036 4:43981825-43981847 AATAGTGAGGAGTAAGTGGAGGG - Intergenic
974597692 4:64036628-64036650 AAGGGGGAGGGGAAGGGGGAGGG - Intergenic
975383272 4:73727033-73727055 AGATGTGAGTGAAAAGTGGAGGG + Intergenic
976827043 4:89272282-89272304 AAAATTGAGTGGAAAGTGGAAGG + Intronic
977249483 4:94674118-94674140 GAGTGTCAGGGGAAAGTGTGGGG - Intergenic
978177178 4:105746333-105746355 AAGGATGAGGAGGAAGTGGAGGG + Intronic
978594737 4:110365036-110365058 AAGTATGAGGGGAGAGGTGAGGG - Intergenic
978774592 4:112492880-112492902 AAGGGTGAGAGCCAAGTGGACGG - Intergenic
979201908 4:117988668-117988690 AAGAAAGAGGGGAAAGTTGATGG - Intergenic
980157063 4:129120605-129120627 GGGGGTGAGGGGAAAGGGGAGGG - Intergenic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
980435571 4:132767638-132767660 AAGAGAGAGAGGAAAGTGGGAGG + Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
980753750 4:137128806-137128828 ATGTGTGTGGGTAAAGTGAAGGG - Intergenic
980896998 4:138869158-138869180 GAGGGTGAGGGGAGAGGGGAGGG + Intergenic
980901017 4:138905267-138905289 AAGTGTGGGGAGAGAGGGGAGGG + Intergenic
980972261 4:139577784-139577806 AAGAGCCAGGGGAAAGTGAATGG + Intronic
980981308 4:139656748-139656770 AACTGCGAGGGGATAGAGGAGGG - Intergenic
981027140 4:140088201-140088223 AAGTGTGATGGGAGGGAGGAAGG + Intronic
981258783 4:142694797-142694819 AAATGTTAAGGGAAAGTGTAGGG - Intronic
981616887 4:146651813-146651835 AGGGGGGAGGGGAAAATGGAAGG - Intergenic
982140372 4:152311698-152311720 ATGGTTGGGGGGAAAGTGGAGGG - Intergenic
982268256 4:153560047-153560069 AAGTGTGAGTTGAAAAAGGAAGG - Intronic
982517951 4:156375629-156375651 AGGGGTGAGGGGCAAGAGGAGGG + Intergenic
983463964 4:168063254-168063276 AAGGATGTGGAGAAAGTGGAAGG + Intergenic
984462530 4:180056554-180056576 AAGTGTGTGGGGAAATGGGGAGG + Intergenic
984658161 4:182342467-182342489 AGGGGTGAGGGGAAAATAGAAGG + Intronic
984911456 4:184676968-184676990 AAGTGAAGGGGGAAAGAGGAAGG - Intronic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985679557 5:1248848-1248870 AAGGGTGAGGGACAAGTTGAAGG - Intergenic
986178800 5:5374329-5374351 ATGTGAGAGGAGAAAGGGGATGG + Intergenic
986891980 5:12320384-12320406 CAGTGTGAGGAGGAAGTGGATGG + Intergenic
988378978 5:30477037-30477059 AACTGTGAGGGCAGTGTGGAAGG - Intergenic
988735984 5:34021764-34021786 CAGGGTGAGGGGAAAGGGGAGGG + Intronic
988841361 5:35086975-35086997 AAAAGTGAAGGGAAAGGGGAAGG - Intronic
990821679 5:59847438-59847460 AAGTGTGAGGTGTACGGGGAGGG + Intronic
991379200 5:66001955-66001977 GGGAGTGAGGGGAAAGTGGAGGG - Intronic
991687578 5:69195839-69195861 GGGTATGAGGGGAAAGTGGAGGG + Intronic
992578973 5:78151835-78151857 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
992668622 5:79036249-79036271 AGGTGTGAAGTGAAAGTAGAAGG + Intronic
993764064 5:91833573-91833595 GGGTGTGGGGGGAAAGGGGAGGG - Intergenic
995061628 5:107817068-107817090 AAGAATGAGGGGAAAGTAAAGGG + Intergenic
995075752 5:107981086-107981108 AACTGTGAGGGAAAATGGGAGGG + Intronic
995088345 5:108141553-108141575 AAGAGTGATGGGAAAGAGAAAGG - Intronic
995126274 5:108579656-108579678 AAGTGTGAGGGGGGAAGGGAAGG - Intergenic
995294419 5:110502672-110502694 GTGAGTGAGGGGAAAGTGGAAGG - Intronic
995386474 5:111595328-111595350 AAGGGTGATGGCAAAATGGATGG + Intergenic
995972698 5:117991776-117991798 AAGTTTGAGGGCAGAATGGATGG - Intergenic
996060193 5:119024466-119024488 GGGGGTGAGGGGAAAGGGGAGGG - Intergenic
997659989 5:135582119-135582141 AAGTGTGGGGGCACAGAGGAGGG + Intergenic
997854213 5:137358534-137358556 AAGGAAGAGGGGAAGGTGGAGGG + Intronic
999061570 5:148641127-148641149 TAGGGTGAGGGGGATGTGGAAGG + Intronic
1000360387 5:160441568-160441590 AAGTGTGGGGGAAAAGTAGAGGG + Intergenic
1001269175 5:170298164-170298186 TGGTGGGAGGGGAAAGTGGTTGG - Exonic
1001290644 5:170456309-170456331 GAGGGTGGGGGGCAAGTGGAGGG + Intronic
1001645270 5:173276697-173276719 CAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1001693994 5:173656068-173656090 CAATGTGAGGGGTCAGTGGATGG - Intergenic
1001995417 5:176153595-176153617 CAGTGTGCGGGGAAAGGGGTGGG + Intergenic
1002027423 5:176404879-176404901 AACTGTGAGGGGACACTGGCAGG - Intronic
1002138406 5:177122821-177122843 AATTGAGAGGGGAAGGTTGAAGG - Intergenic
1003507287 6:6750404-6750426 AGGTGGGAAGGGAAAGTGCATGG + Intergenic
1003541733 6:7024259-7024281 AAGTGTGAGGGGCATAAGGAAGG - Intergenic
1003568812 6:7242538-7242560 AAGTGGGAGGGAAAAGTTTAGGG + Intronic
1003904456 6:10686392-10686414 AAGTGGGAAGGGAATGGGGAAGG + Intronic
1004015424 6:11727896-11727918 AAGAGAGAGGGGAAAGAAGAAGG + Intronic
1005217169 6:23543983-23544005 ATGAGTGAGGGGGATGTGGAAGG + Intergenic
1005431757 6:25764771-25764793 AAGCGTGAGGGGAAAGCTGCAGG - Intronic
1006200502 6:32284642-32284664 GGGTGTGAGGGGCAAGAGGAGGG + Intergenic
1006369623 6:33635832-33635854 AGGGGTGAGGGGAAGGGGGATGG + Intronic
1006369739 6:33636525-33636547 AGGTGTGAGGTGTGAGTGGAAGG + Intronic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1007408756 6:41649579-41649601 AAGTGTGATGGGAAAAGGGTGGG - Intronic
1007855383 6:44850295-44850317 AAAGGTTAGGGGGAAGTGGAGGG - Intronic
1007967564 6:46016106-46016128 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967574 6:46016131-46016153 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967584 6:46016156-46016178 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967594 6:46016181-46016203 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1007967604 6:46016206-46016228 AAGAGGAAGGGGAAAGGGGAAGG + Intronic
1008411271 6:51182875-51182897 ATGTGTGAGGGGTCAGAGGATGG + Intergenic
1008781690 6:55114116-55114138 AACTTTGGGGGAAAAGTGGAAGG + Intronic
1008862753 6:56169751-56169773 AAGTGTTAGTGGAGTGTGGATGG - Intronic
1009440883 6:63676800-63676822 AACTGTCAGGGGAGAGGGGATGG + Intronic
1010043864 6:71419420-71419442 AAGTCTGAGGGTGAAGTGGCAGG - Intergenic
1010053949 6:71541800-71541822 AAGTGTGAGATGACAGTGGCAGG - Intergenic
1010445488 6:75944255-75944277 AACAGTGAGGGGAAGGAGGAAGG - Intronic
1010905402 6:81480552-81480574 AGGTGATAGGAGAAAGTGGAGGG - Intergenic
1011088166 6:83566199-83566221 AAGGGTAAGGGGAAATTGAAAGG + Intronic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1012184307 6:96194053-96194075 TAGTGTCAGGGGAGAGGGGAGGG + Intronic
1012680102 6:102169312-102169334 TAGGGTTAGGGGAAAGAGGAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013323178 6:109015671-109015693 GAATGTGAGGGGGAAATGGACGG + Intronic
1014308704 6:119771756-119771778 AGGAGAGAGGGGAAAGGGGAAGG + Intergenic
1014689583 6:124546694-124546716 AAGTCTTAGGAGAAAGTGGAAGG + Intronic
1015575351 6:134665433-134665455 AAGGGGGAGGGGGAAGGGGATGG + Intergenic
1015973229 6:138763407-138763429 AAAAGGGAGGGGAAAATGGAAGG - Intronic
1016147996 6:140700676-140700698 AAGGGTGGGGGGCAAGGGGAAGG - Intergenic
1017279498 6:152608033-152608055 AGGGGTGAGGGGCAAGGGGAGGG + Intronic
1017961554 6:159226559-159226581 GAGACTGAGGGGAAAGTGAAAGG + Exonic
1018328674 6:162704103-162704125 AAGAGTGAGGGTAAAGTGTGAGG + Intronic
1018688842 6:166326839-166326861 AAGTTTGAGGGGTAAGTGCCAGG + Intronic
1018793905 6:167171474-167171496 AGGTGTGAGGGGAATGTGAATGG - Intronic
1018822430 6:167383617-167383639 GGGTGTGAGGGGAATGTGAATGG + Intronic
1018880378 6:167872821-167872843 AAATGGGAGGTGGAAGTGGAGGG - Intronic
1018990775 6:168671739-168671761 CAGCGTGAGGACAAAGTGGAGGG - Intronic
1019816681 7:3206114-3206136 AAGTGAATGGGGACAGTGGAGGG - Intergenic
1022574299 7:31482683-31482705 AAGGGTGAGGGAAAAATTGAGGG + Intergenic
1022957782 7:35397325-35397347 CAGGGTGAGGGGACAGAGGATGG - Intergenic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1023980925 7:45069572-45069594 AAGTGTGAGGGGACTGTGCAGGG - Intronic
1024117813 7:46209787-46209809 TAAGGTGAGGGGACAGTGGAGGG - Intergenic
1024434327 7:49331769-49331791 GGGGGTGAGGGGAAAGGGGAGGG + Intergenic
1024725463 7:52189371-52189393 AAGGGAGAGGGGAAAGGAGAGGG + Intergenic
1024737684 7:52323361-52323383 AAGGGAGAAGGGAAAGGGGAAGG - Intergenic
1024737699 7:52323401-52323423 AAGGGAGAAGGGAAAGGGGAAGG - Intergenic
1024947784 7:54828487-54828509 AAGTGTGAGAGGAACATGCATGG - Intergenic
1024977326 7:55125945-55125967 GAGTGTGAGGGGAAGTGGGATGG - Intronic
1026120869 7:67536145-67536167 GGGTGTTAGGGGAAAGCGGAGGG - Intergenic
1027512445 7:79099618-79099640 AAGGGTGAAGGGAGAGAGGAGGG - Intronic
1027541780 7:79476249-79476271 AGGAGTGAGGGGAAAAGGGAGGG - Intergenic
1028433512 7:90775627-90775649 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
1028433519 7:90775639-90775661 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
1028584607 7:92440294-92440316 AAGGGGGAAGGGAAAGGGGAAGG + Intergenic
1028821195 7:95213976-95213998 GATTGTGAGTGGAAACTGGAAGG - Intronic
1029020215 7:97357234-97357256 AGGAGTGGGGGGAAGGTGGAAGG + Intergenic
1030638270 7:111974624-111974646 AAGTGAGAGGGAAAAGTGGAGGG + Intronic
1031053124 7:116965406-116965428 AAGGGTGGGGGGCAAGGGGAGGG + Intronic
1031120324 7:117714701-117714723 AAGTGTGAGGCTAGAATGGAAGG + Intronic
1031866044 7:127039795-127039817 GAGTGGGAAGGGGAAGTGGAAGG + Intronic
1032258771 7:130317863-130317885 AAGTTGGAGGGGAGAGTGGGCGG - Intronic
1032645473 7:133818973-133818995 AAGTGGGAGGAGAAAGAGGGTGG + Intronic
1032888963 7:136172780-136172802 GAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1033014251 7:137655832-137655854 AAGTGTGAAAGGAAAGAGGATGG + Intronic
1033397618 7:140990851-140990873 TAGTGTGAGGGGACTGTGGCAGG + Intergenic
1033969813 7:147025405-147025427 AAGGGGGAGGGGAAGGGGGAGGG + Intronic
1033991369 7:147291311-147291333 TGGAGTGAGGGGAAAGGGGAGGG - Intronic
1034165518 7:149022206-149022228 AAGTGTGAAGGGGAAGAGGGCGG + Intronic
1034329383 7:150269471-150269493 AGGTCTGAGGGGAAATTAGAGGG + Intronic
1034468809 7:151245205-151245227 AAGGGTGAGGGGAGCGTGCAGGG + Intronic
1034668672 7:152840390-152840412 AGGTCTGAGGGGAAATTAGAGGG - Intronic
1035129197 7:156636610-156636632 AAGTGTGAGTAGAAAGTTAAAGG + Intergenic
1035553339 8:545563-545585 AAGGCTGAGGGGAAGGTGGAGGG + Intronic
1035651537 8:1269420-1269442 AAGTGTTACAGGAAGGTGGATGG - Intergenic
1036166378 8:6437894-6437916 AACTGTAAGGAGACAGTGGAGGG - Intronic
1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG + Intergenic
1037570295 8:20152216-20152238 AAATATAAGAGGAAAGTGGAGGG + Intronic
1038054128 8:23842313-23842335 AAGTTTAAGGGGGAATTGGAGGG + Exonic
1038285716 8:26204697-26204719 AAGAGGGAGGGGAAAGTAGGGGG - Intergenic
1038752143 8:30305518-30305540 GAGTGTGAGAGGAAGGTGAATGG - Intergenic
1039412012 8:37362741-37362763 AGGGGTGAGGGGAAAGGGGAGGG + Intergenic
1039927590 8:41950932-41950954 AAGGGAGAGGGGAGAGAGGAAGG + Intronic
1040516123 8:48136532-48136554 ATGTCTGAGGGGCAAGGGGAGGG - Intergenic
1041302387 8:56426365-56426387 GAGTGTGAAGGGAGAGAGGAGGG - Intergenic
1041304554 8:56446349-56446371 AAATGTGAAGGGAAAGAGGGCGG + Intronic
1041330525 8:56719328-56719350 AAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1042289572 8:67155216-67155238 AAGTGTGAGTGTGAAGGGGAGGG - Intronic
1042441628 8:68834047-68834069 AAGAGAGAGGAAAAAGTGGAAGG + Intergenic
1042975745 8:74467183-74467205 AAGTTTGAGGAGAAAGGAGAAGG + Intronic
1043308762 8:78831684-78831706 ATATGTGAGGGTAAAGTAGAAGG - Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1044313225 8:90719346-90719368 GGGTGTGGGGGGAAAGGGGAGGG + Intronic
1044600177 8:93996027-93996049 AAGGGTGATGGGAAAGAGAAGGG - Intergenic
1044933199 8:97269779-97269801 AATTGTGAGGGGAAAGCCAAGGG + Intergenic
1045052145 8:98336989-98337011 ATGTGTGTGGGGGAAGGGGAGGG + Intergenic
1045491367 8:102671562-102671584 AACTGGGAGGAAAAAGTGGAAGG + Intergenic
1045724209 8:105152047-105152069 AGGTGAGAGAGGAAAGTGCATGG + Intronic
1046017571 8:108623676-108623698 AATTTTCAGGGGAAAGTTGATGG + Intronic
1046238542 8:111460252-111460274 AAGTGTGAGAAGAAAGTGCCAGG - Intergenic
1046424388 8:114027545-114027567 CACTGTGAGGGGAAAATGGTTGG + Intergenic
1046813705 8:118560453-118560475 AAGAGTCAGGAGACAGTGGATGG + Intronic
1047159607 8:122363092-122363114 AAGAGTGAGAGCAAAGTGAAAGG + Intergenic
1047684350 8:127289343-127289365 AAGTTTCATGGGAAAGAGGAAGG - Intergenic
1047787162 8:128164794-128164816 AAGAATGAGGGGGCAGTGGATGG + Intergenic
1048294117 8:133201882-133201904 ACATGTGTGGGGAAAATGGAAGG + Intronic
1048516570 8:135116800-135116822 GAGGGGGAGGGGAAAGGGGAGGG - Intergenic
1048575824 8:135689268-135689290 AAGTGTGGAAGGAAAGAGGAAGG + Intergenic
1048625343 8:136179128-136179150 GAGTGTGATGGGATAGGGGAAGG - Intergenic
1049566505 8:143341854-143341876 AAGGGGGAGGAGAAAGAGGAAGG - Intronic
1051745401 9:20290645-20290667 CAGGGTGAGGGGAAAGAGCAGGG + Intergenic
1052017756 9:23489173-23489195 AAGAATGAGGGGAAAGTGTCTGG - Intergenic
1052102279 9:24463222-24463244 ATCTGTGGGGGGAAAGGGGAAGG - Intergenic
1052328823 9:27246074-27246096 AGGTATGAGAAGAAAGTGGAGGG + Intergenic
1052947445 9:34179362-34179384 AGGTGGGAGGGAAAAGTGGCCGG + Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1056262829 9:84865580-84865602 AAGTGTGAGGGAAAAGGTAAAGG + Intronic
1056387976 9:86115205-86115227 AGGCGTGAGGGGGAAATGGAGGG + Intergenic
1056567206 9:87784582-87784604 AAGTCTGTGTGGAAAGTGCATGG - Intergenic
1056870473 9:90272788-90272810 GGATGTGAGAGGAAAGTGGAGGG + Intergenic
1057099371 9:92343439-92343461 GAGTTTGTGGGGAAAGTGGCAGG + Intronic
1058247881 9:102653460-102653482 AAGTGTGAGGGGGAAAAGGAGGG + Intergenic
1058361875 9:104157237-104157259 AAATGTGAGTGGACAGTGGGAGG - Intergenic
1058829696 9:108804905-108804927 AGGGGTGGGGGGAAAGGGGAAGG + Intergenic
1059143500 9:111876263-111876285 AAGTGAGAGTGGAAAGTGAAGGG - Intergenic
1059249902 9:112879292-112879314 CAGCCTGAGGGGAATGTGGAAGG - Exonic
1060025863 9:120170829-120170851 AAGTGTGTTAGGAAAGTGTAAGG + Intergenic
1060131720 9:121106619-121106641 AAGTTTGAGAAGAAAGAGGAAGG + Intronic
1060241383 9:121906668-121906690 AAGGGAAAGGGGAAAGGGGAAGG + Intronic
1060279351 9:122205565-122205587 AAGTGTGAGGGGCATCTGGTGGG + Intronic
1061255515 9:129452820-129452842 AAGCGAGAAGGGAACGTGGAAGG - Intergenic
1061355065 9:130098375-130098397 ATGTGTGAGGAGAAAGTGCCAGG - Intronic
1061590621 9:131595253-131595275 AAGGGTGAGGGAACAGTGAAGGG + Intronic
1062060606 9:134493347-134493369 AAGTGTGAGTGGAGAGTGTGGGG + Intergenic
1062182084 9:135196272-135196294 AAATGGGAGGGGAAATGGGAAGG - Intergenic
1062182123 9:135196384-135196406 AAATGGGAGGGGAAATGGGAAGG - Intergenic
1062182180 9:135196546-135196568 AAATGGGAGGGGAAATGGGAAGG - Intergenic
1062182184 9:135196558-135196580 AAATGGGAGGGGAAATGGGAGGG - Intergenic
1062182215 9:135196633-135196655 AAATGGGAGGGGAAATGGGAAGG - Intergenic
1203532602 Un_GL000213v1:160921-160943 AAGAGTGAGTGGAAAGGGCAGGG + Intergenic
1187089248 X:16077428-16077450 AACTGTGAAGGGAAAGGGGAAGG + Intergenic
1187629995 X:21158671-21158693 AATTGTAAGTGGAAAATGGATGG + Intergenic
1189575762 X:42351389-42351411 AAGTTTGAGAGGAAGGAGGACGG + Intergenic
1189777248 X:44481603-44481625 GAGTGTCAGGGGAAAGAGGAAGG + Intergenic
1189892964 X:45624651-45624673 AGAAGTGAGGGGAAAGTGGCTGG + Intergenic
1190319098 X:49169397-49169419 AAGAGTGAGTGAATAGTGGAAGG - Intergenic
1192223941 X:69215770-69215792 TAGTGTGAGGGGAATGTGAGGGG + Intergenic
1192233105 X:69279268-69279290 AAGGGTGACGGGACAGTGGCAGG - Intergenic
1192481486 X:71490054-71490076 AAGTAGGAGGGGAAAGTGGAGGG - Intronic
1193772985 X:85609666-85609688 AAGTATGTGGGGAAAATGGGTGG + Intergenic
1194307273 X:92263117-92263139 AAATCTGAAGGGAAAGTGGCAGG + Exonic
1194348524 X:92796048-92796070 AAGGGGGAGGGGAGAGGGGAGGG + Intergenic
1195390131 X:104353081-104353103 AGGTGTGAAGGGAAAGTGATGGG + Intergenic
1196068071 X:111487769-111487791 AACTGAGAGGGGAAAGTAGCAGG - Intergenic
1196322675 X:114360700-114360722 AAGGGTAGTGGGAAAGTGGAGGG + Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1196979347 X:121194554-121194576 AAGTCTGAGGGCAAACAGGATGG + Intergenic
1197088139 X:122503675-122503697 ATTAGAGAGGGGAAAGTGGAAGG - Intergenic
1197449314 X:126592467-126592489 AGGGGTGGGGGGAAAGGGGAGGG - Intergenic
1197841687 X:130754736-130754758 AAGGGGGAGGGGAGAGAGGAAGG + Intronic
1198773121 X:140151616-140151638 GAGGGTGGGGGGAAAGGGGAGGG - Intergenic
1198790338 X:140338731-140338753 AAGTCTAAGGGCAAAGTGCAAGG + Intergenic
1199444687 X:147908827-147908849 AAGTGAAGGGGGAAAGTAGAAGG + Intergenic
1200244120 X:154513830-154513852 AAAGGTTAGGGGAAAGAGGATGG - Intronic
1200616084 Y:5381168-5381190 AAGTCTGAGAGGTAACTGGAGGG - Intronic
1200656855 Y:5912685-5912707 AAGGGGGAGGGGAGAGGGGAGGG + Intergenic
1201594509 Y:15652644-15652666 AATTGTGGGGGGAAAATAGATGG + Intergenic