ID: 1148733834

View in Genome Browser
Species Human (GRCh38)
Location 17:49853397-49853419
Sequence TTTCAGAAGCAGAGGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148733831_1148733834 -10 Left 1148733831 17:49853384-49853406 CCTTAAAGGTAGATTTCAGAAGC No data
Right 1148733834 17:49853397-49853419 TTTCAGAAGCAGAGGGAGCCAGG No data
1148733827_1148733834 27 Left 1148733827 17:49853347-49853369 CCGGCCTATTTCTTAGACAAGGT No data
Right 1148733834 17:49853397-49853419 TTTCAGAAGCAGAGGGAGCCAGG No data
1148733825_1148733834 28 Left 1148733825 17:49853346-49853368 CCCGGCCTATTTCTTAGACAAGG No data
Right 1148733834 17:49853397-49853419 TTTCAGAAGCAGAGGGAGCCAGG No data
1148733828_1148733834 23 Left 1148733828 17:49853351-49853373 CCTATTTCTTAGACAAGGTTGAG No data
Right 1148733834 17:49853397-49853419 TTTCAGAAGCAGAGGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148733834 Original CRISPR TTTCAGAAGCAGAGGGAGCC AGG Intergenic
No off target data available for this crispr