ID: 1148734661

View in Genome Browser
Species Human (GRCh38)
Location 17:49858669-49858691
Sequence GCCCACCTGCCCCTGGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148734661_1148734665 -7 Left 1148734661 17:49858669-49858691 CCGGCGCCCAGGGGCAGGTGGGC No data
Right 1148734665 17:49858685-49858707 GGTGGGCGAGGACGATGTTGAGG No data
1148734661_1148734669 11 Left 1148734661 17:49858669-49858691 CCGGCGCCCAGGGGCAGGTGGGC No data
Right 1148734669 17:49858703-49858725 TGAGGCTTGAAGATTTGGGGAGG No data
1148734661_1148734667 7 Left 1148734661 17:49858669-49858691 CCGGCGCCCAGGGGCAGGTGGGC No data
Right 1148734667 17:49858699-49858721 ATGTTGAGGCTTGAAGATTTGGG No data
1148734661_1148734666 6 Left 1148734661 17:49858669-49858691 CCGGCGCCCAGGGGCAGGTGGGC No data
Right 1148734666 17:49858698-49858720 GATGTTGAGGCTTGAAGATTTGG No data
1148734661_1148734668 8 Left 1148734661 17:49858669-49858691 CCGGCGCCCAGGGGCAGGTGGGC No data
Right 1148734668 17:49858700-49858722 TGTTGAGGCTTGAAGATTTGGGG No data
1148734661_1148734670 28 Left 1148734661 17:49858669-49858691 CCGGCGCCCAGGGGCAGGTGGGC No data
Right 1148734670 17:49858720-49858742 GGGAGGCCAAAGCCAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148734661 Original CRISPR GCCCACCTGCCCCTGGGCGC CGG (reversed) Intergenic