ID: 1148736818

View in Genome Browser
Species Human (GRCh38)
Location 17:49869650-49869672
Sequence ACTTCTGGTGCTGCAGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148736804_1148736818 1 Left 1148736804 17:49869626-49869648 CCGCCCCCCACCCCCGGGCCCAG No data
Right 1148736818 17:49869650-49869672 ACTTCTGGTGCTGCAGATCCAGG No data
1148736812_1148736818 -9 Left 1148736812 17:49869636-49869658 CCCCCGGGCCCAGGACTTCTGGT No data
Right 1148736818 17:49869650-49869672 ACTTCTGGTGCTGCAGATCCAGG No data
1148736808_1148736818 -4 Left 1148736808 17:49869631-49869653 CCCCACCCCCGGGCCCAGGACTT No data
Right 1148736818 17:49869650-49869672 ACTTCTGGTGCTGCAGATCCAGG No data
1148736809_1148736818 -5 Left 1148736809 17:49869632-49869654 CCCACCCCCGGGCCCAGGACTTC No data
Right 1148736818 17:49869650-49869672 ACTTCTGGTGCTGCAGATCCAGG No data
1148736806_1148736818 -2 Left 1148736806 17:49869629-49869651 CCCCCCACCCCCGGGCCCAGGAC No data
Right 1148736818 17:49869650-49869672 ACTTCTGGTGCTGCAGATCCAGG No data
1148736813_1148736818 -10 Left 1148736813 17:49869637-49869659 CCCCGGGCCCAGGACTTCTGGTG No data
Right 1148736818 17:49869650-49869672 ACTTCTGGTGCTGCAGATCCAGG No data
1148736800_1148736818 27 Left 1148736800 17:49869600-49869622 CCATGGCCACTGAGGAGAGGCTT No data
Right 1148736818 17:49869650-49869672 ACTTCTGGTGCTGCAGATCCAGG No data
1148736801_1148736818 21 Left 1148736801 17:49869606-49869628 CCACTGAGGAGAGGCTTATACCG No data
Right 1148736818 17:49869650-49869672 ACTTCTGGTGCTGCAGATCCAGG No data
1148736810_1148736818 -6 Left 1148736810 17:49869633-49869655 CCACCCCCGGGCCCAGGACTTCT No data
Right 1148736818 17:49869650-49869672 ACTTCTGGTGCTGCAGATCCAGG No data
1148736807_1148736818 -3 Left 1148736807 17:49869630-49869652 CCCCCACCCCCGGGCCCAGGACT No data
Right 1148736818 17:49869650-49869672 ACTTCTGGTGCTGCAGATCCAGG No data
1148736799_1148736818 28 Left 1148736799 17:49869599-49869621 CCCATGGCCACTGAGGAGAGGCT No data
Right 1148736818 17:49869650-49869672 ACTTCTGGTGCTGCAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148736818 Original CRISPR ACTTCTGGTGCTGCAGATCC AGG Intergenic
No off target data available for this crispr