ID: 1148738679

View in Genome Browser
Species Human (GRCh38)
Location 17:49879825-49879847
Sequence CCTCACCCTCGCCCCAGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148738679_1148738686 14 Left 1148738679 17:49879825-49879847 CCTAACCTGGGGCGAGGGTGAGG No data
Right 1148738686 17:49879862-49879884 TAGAAACTCTTTGTTCCAGGTGG No data
1148738679_1148738685 11 Left 1148738679 17:49879825-49879847 CCTAACCTGGGGCGAGGGTGAGG No data
Right 1148738685 17:49879859-49879881 GACTAGAAACTCTTTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148738679 Original CRISPR CCTCACCCTCGCCCCAGGTT AGG (reversed) Intergenic
No off target data available for this crispr