ID: 1148739408

View in Genome Browser
Species Human (GRCh38)
Location 17:49883971-49883993
Sequence AAGCCCTCCTGGTTTTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148739402_1148739408 5 Left 1148739402 17:49883943-49883965 CCAGGGGAAGTCCCAGGTCCATG No data
Right 1148739408 17:49883971-49883993 AAGCCCTCCTGGTTTTCACCAGG No data
1148739398_1148739408 22 Left 1148739398 17:49883926-49883948 CCTGGCTCTGTGACAAGCCAGGG No data
Right 1148739408 17:49883971-49883993 AAGCCCTCCTGGTTTTCACCAGG No data
1148739396_1148739408 27 Left 1148739396 17:49883921-49883943 CCGCTCCTGGCTCTGTGACAAGC No data
Right 1148739408 17:49883971-49883993 AAGCCCTCCTGGTTTTCACCAGG No data
1148739405_1148739408 -7 Left 1148739405 17:49883955-49883977 CCAGGTCCATGAGGCAAAGCCCT No data
Right 1148739408 17:49883971-49883993 AAGCCCTCCTGGTTTTCACCAGG No data
1148739404_1148739408 -6 Left 1148739404 17:49883954-49883976 CCCAGGTCCATGAGGCAAAGCCC No data
Right 1148739408 17:49883971-49883993 AAGCCCTCCTGGTTTTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148739408 Original CRISPR AAGCCCTCCTGGTTTTCACC AGG Intergenic
No off target data available for this crispr