ID: 1148740061

View in Genome Browser
Species Human (GRCh38)
Location 17:49887642-49887664
Sequence TCCCTTTGTGGTAGTGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 325}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148740047_1148740061 16 Left 1148740047 17:49887603-49887625 CCTTTCAGATCCACCTGACTTGG 0: 1
1: 0
2: 0
3: 13
4: 208
Right 1148740061 17:49887642-49887664 TCCCTTTGTGGTAGTGATGGGGG 0: 1
1: 0
2: 1
3: 20
4: 325
1148740050_1148740061 6 Left 1148740050 17:49887613-49887635 CCACCTGACTTGGCCAGGCCACC 0: 1
1: 0
2: 2
3: 20
4: 295
Right 1148740061 17:49887642-49887664 TCCCTTTGTGGTAGTGATGGGGG 0: 1
1: 0
2: 1
3: 20
4: 325
1148740051_1148740061 3 Left 1148740051 17:49887616-49887638 CCTGACTTGGCCAGGCCACCCCT 0: 1
1: 0
2: 3
3: 17
4: 242
Right 1148740061 17:49887642-49887664 TCCCTTTGTGGTAGTGATGGGGG 0: 1
1: 0
2: 1
3: 20
4: 325
1148740052_1148740061 -7 Left 1148740052 17:49887626-49887648 CCAGGCCACCCCTTCTTCCCTTT 0: 1
1: 0
2: 3
3: 48
4: 659
Right 1148740061 17:49887642-49887664 TCCCTTTGTGGTAGTGATGGGGG 0: 1
1: 0
2: 1
3: 20
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148740061 Original CRISPR TCCCTTTGTGGTAGTGATGG GGG Intergenic