ID: 1148742199

View in Genome Browser
Species Human (GRCh38)
Location 17:49899150-49899172
Sequence CTACCTTGAAGCCGCTTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148742199_1148742205 -6 Left 1148742199 17:49899150-49899172 CCCGAGAAGCGGCTTCAAGGTAG 0: 1
1: 0
2: 1
3: 10
4: 77
Right 1148742205 17:49899167-49899189 AGGTAGTGCCTTTGGGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148742199 Original CRISPR CTACCTTGAAGCCGCTTCTC GGG (reversed) Intergenic
900759256 1:4460160-4460182 CTACCTTGCAGCAGCTCCTGTGG - Intergenic
900935609 1:5764626-5764648 CTGCCTTGCAGCGGCTGCTCGGG - Intergenic
906483914 1:46220104-46220126 CCACCTTGAAGCCTCTCCCCTGG - Exonic
906683749 1:47749173-47749195 CAACCTTGCAGCCACTTCTTAGG + Intergenic
920635758 1:207701668-207701690 CTACCTTCTAGCCACATCTCAGG + Intronic
923099409 1:230800508-230800530 CTACCTTGAAGCTGCAGCACTGG - Intronic
1064655333 10:17550608-17550630 CTACCTTTGAGCTGCTACTCTGG - Intergenic
1064811579 10:19205694-19205716 CTGCCTTGCAGCCACATCTCAGG - Intronic
1066550397 10:36549656-36549678 CTACCTGGAAACTGCTTGTCAGG + Intergenic
1073567958 10:104551670-104551692 CTACCTCTAAGCAGCATCTCAGG - Intergenic
1074598104 10:114885976-114885998 TTCCCTTAAAGCGGCTTCTCAGG + Intronic
1075018407 10:118928292-118928314 CTAACTTGAAGCCATTTCTGTGG - Intergenic
1076333915 10:129692290-129692312 CTGCCTGGAAGCCGCCGCTCAGG - Intronic
1076507528 10:130987716-130987738 CTCCCTTGAAGAAGCTTCCCTGG - Intergenic
1083557441 11:63642125-63642147 CTCCCTTGAAACTGCTTTTCAGG + Intronic
1084447995 11:69215179-69215201 ATACCTGGCAGCCCCTTCTCTGG - Intergenic
1085189049 11:74601892-74601914 CTGCCTAGAAGGCTCTTCTCAGG - Intronic
1088526474 11:110761639-110761661 CTACCTTGATGCTACTTCTGGGG + Intergenic
1091994865 12:4985465-4985487 AGCCCTTGAAGCCCCTTCTCTGG + Intergenic
1094457108 12:30647744-30647766 CTACATTGAAGCCTGTTATCGGG - Intronic
1103043109 12:117712062-117712084 CTCACTTGAAGCCCCTTTTCTGG - Intronic
1117999165 14:61506780-61506802 CATCCATGAAGCCTCTTCTCAGG + Intronic
1125009078 15:34850456-34850478 TTACCTTGACTCAGCTTCTCAGG - Intergenic
1129112137 15:73343561-73343583 CTACCATGAACCAGCTTTTCAGG + Exonic
1132808996 16:1788721-1788743 CCACCTTGCAGCCGCTTTCCAGG + Exonic
1137581771 16:49637973-49637995 CCACCTTGAAGCCGCTGCGGGGG - Exonic
1141460511 16:84176277-84176299 CTTCCTTGCAGCCTCTTCTCCGG + Exonic
1146658306 17:34648304-34648326 CTGCCTTGGAGCTGCTACTCTGG - Intergenic
1148742199 17:49899150-49899172 CTACCTTGAAGCCGCTTCTCGGG - Intergenic
1151227728 17:72659074-72659096 CCACCTGGAAGCCTCTTCTCAGG + Intronic
1151803350 17:76390636-76390658 CTCCCTTGCTGCCCCTTCTCAGG - Exonic
1203171091 17_GL000205v2_random:148379-148401 CTTTCTTGAAGCAGCTGCTCAGG + Intergenic
1155876388 18:31095181-31095203 CTACCTGGAAGACTCTTCCCTGG - Intronic
1160914594 19:1490603-1490625 CAACAGTGAACCCGCTTCTCTGG - Intronic
1163474348 19:17516287-17516309 CTCCCTTGCGGCCGCTCCTCGGG - Intronic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
925740344 2:7000064-7000086 CTCCCCTGAAGCAGGTTCTCCGG + Intronic
927497717 2:23562067-23562089 CATCCATGAAGCCCCTTCTCTGG - Intronic
928228872 2:29478731-29478753 CCTCTTTGAAGCCTCTTCTCAGG - Intronic
931101629 2:59008416-59008438 CTACCTTGGAGCCTCCTCGCTGG + Intergenic
933615639 2:84479764-84479786 CTACCTTGGAGTCCTTTCTCAGG - Intergenic
937336216 2:121064008-121064030 CTACCTTGCAGCCGCTCCTATGG - Intergenic
946247174 2:218394513-218394535 ATACACTGAGGCCGCTTCTCTGG - Intronic
1169915291 20:10676706-10676728 CTTCCTTGAAGCCGGTTGTCAGG + Intergenic
1173981740 20:47229641-47229663 GTACCATGAAGAAGCTTCTCTGG - Intronic
1174040621 20:47697125-47697147 CTACCTGGAAGCCTCTTTTCGGG + Intronic
1176327075 21:5510210-5510232 CTTTCTTGAAGCAGCTGCTCAGG + Intergenic
1176330636 21:5546001-5546023 CTTTCTTGAAGCAGCTGCTCAGG - Intergenic
1176397121 21:6274950-6274972 CTTTCTTGAAGCAGCTGCTCAGG + Intergenic
1176400682 21:6310741-6310763 CTTTCTTGAAGCAGCTGCTCAGG - Intergenic
1176436475 21:6678363-6678385 CTTTCTTGAAGCAGCTGCTCAGG + Intergenic
1176440036 21:6714154-6714176 CTTTCTTGAAGCAGCTGCTCAGG - Intergenic
1176460737 21:7005433-7005455 CTTTCTTGAAGCAGCTGCTCAGG + Intergenic
1176464298 21:7041223-7041245 CTTTCTTGAAGCAGCTGCTCAGG - Intergenic
1176484298 21:7387211-7387233 CTTTCTTGAAGCAGCTGCTCAGG + Intergenic
1176487859 21:7423002-7423024 CTTTCTTGAAGCAGCTGCTCAGG - Intergenic
1179897107 21:44369250-44369272 CTTCCTTGTAGCTGCTGCTCAGG - Exonic
1181816032 22:25437556-25437578 CAACATTGAAGCCACTGCTCAGG + Intergenic
950940467 3:16885348-16885370 CTACCTTGATGATGCTGCTCCGG - Intronic
951400551 3:22227848-22227870 CTACCTCTGAGCTGCTTCTCTGG + Intronic
951492773 3:23291173-23291195 CTACCTAGAAGTCCCTTATCTGG - Intronic
954241637 3:49298463-49298485 CAACCTTGAAGCCACTTTTTGGG - Intronic
955087920 3:55720915-55720937 TTATCTTGAAGCATCTTCTCTGG - Intronic
955392802 3:58533602-58533624 CCACCTAGAAGCAGCTTCACAGG - Intronic
957870546 3:86085682-86085704 CTACCTTGAAGCTGCTATGCTGG + Intergenic
957884878 3:86274033-86274055 CTGCCTTTGAGCCGCTACTCTGG + Intergenic
969596661 4:8152925-8152947 CTACCTTGAAGTGGGGTCTCAGG - Intronic
973077980 4:45954467-45954489 GTAACTTGAAAGCGCTTCTCAGG + Intergenic
973773865 4:54228506-54228528 CTCCCTTGAAGTCACTTATCTGG - Intronic
982351252 4:154417460-154417482 CTCCCTTGAAGCAGCTTATTGGG - Intronic
982355232 4:154459614-154459636 CTAACTAGAAGCCACTTCGCAGG - Intronic
983191576 4:164760009-164760031 TTACCTGGAATGCGCTTCTCTGG - Intergenic
991922507 5:71670704-71670726 CTGCCTTGAAGCTGCATCTCTGG + Intergenic
993715813 5:91274831-91274853 CTACCTTGAAGCTGCCCCTCTGG + Intergenic
1002915276 6:1523892-1523914 CTGGCTTGAAGCAGCTTTTCTGG - Intergenic
1021602422 7:22377699-22377721 CTGCCTTGCAGCCTCTTGTCAGG + Intergenic
1022321640 7:29293456-29293478 CCACCTTGAAGGTGCTCCTCTGG + Intronic
1031026094 7:116681497-116681519 CTACCTTGAAACCATTTCTTTGG + Intronic
1032413995 7:131722293-131722315 GTACCTTGAAGCTGCTTCTTGGG + Intergenic
1037893446 8:22636383-22636405 CTGCCCTGAGGCTGCTTCTCAGG + Intronic
1041834299 8:62194668-62194690 CTACCCTGAAACCCCTTCTCAGG - Intergenic
1045489347 8:102656718-102656740 CTGCCTGGAAGCCGCTTGTGGGG + Intergenic
1051847340 9:21466055-21466077 CTACCTTGAAGCTGTTTTCCTGG + Intergenic
1057265260 9:93613240-93613262 CTGCCTTGAACCCGCTTCTCAGG - Intronic
1059542619 9:115144945-115144967 CTACCTTGGAGCCAGTTCTCGGG - Intronic
1203431459 Un_GL000195v1:94325-94347 CTTTCTTGAAGCAGCTGCTCAGG + Intergenic
1203435040 Un_GL000195v1:130296-130318 CTTTCTTGAAGCAGCTGCTCAGG - Intergenic
1187080179 X:15977631-15977653 CTAACTTGAGGATGCTTCTCAGG + Intergenic
1196664640 X:118303745-118303767 CTACCTTGAAGCTGGGTCTGTGG - Intergenic