ID: 1148743066

View in Genome Browser
Species Human (GRCh38)
Location 17:49903706-49903728
Sequence ATTCCCTTGCTGTTAGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148743066_1148743069 19 Left 1148743066 17:49903706-49903728 CCTCTAACTAACAGCAAGGGAAT No data
Right 1148743069 17:49903748-49903770 GTCGGTAACCCTCACTGAATTGG No data
1148743066_1148743070 20 Left 1148743066 17:49903706-49903728 CCTCTAACTAACAGCAAGGGAAT No data
Right 1148743070 17:49903749-49903771 TCGGTAACCCTCACTGAATTGGG No data
1148743066_1148743067 1 Left 1148743066 17:49903706-49903728 CCTCTAACTAACAGCAAGGGAAT No data
Right 1148743067 17:49903730-49903752 TTCCAGAGATCAAAGCATGTCGG No data
1148743066_1148743071 26 Left 1148743066 17:49903706-49903728 CCTCTAACTAACAGCAAGGGAAT No data
Right 1148743071 17:49903755-49903777 ACCCTCACTGAATTGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148743066 Original CRISPR ATTCCCTTGCTGTTAGTTAG AGG (reversed) Intergenic
No off target data available for this crispr