ID: 1148744191

View in Genome Browser
Species Human (GRCh38)
Location 17:49909374-49909396
Sequence GCTTCTAGGCAGAGGGGAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148744181_1148744191 14 Left 1148744181 17:49909337-49909359 CCGCTGCAGTTCCTGGGAGGGAG No data
Right 1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG No data
1148744175_1148744191 22 Left 1148744175 17:49909329-49909351 CCTCTCACCCGCTGCAGTTCCTG No data
Right 1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG No data
1148744185_1148744191 3 Left 1148744185 17:49909348-49909370 CCTGGGAGGGAGGATGGCTAGGC No data
Right 1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG No data
1148744180_1148744191 15 Left 1148744180 17:49909336-49909358 CCCGCTGCAGTTCCTGGGAGGGA No data
Right 1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148744191 Original CRISPR GCTTCTAGGCAGAGGGGAGC GGG Intergenic
No off target data available for this crispr