ID: 1148744402

View in Genome Browser
Species Human (GRCh38)
Location 17:49910366-49910388
Sequence CCGCGGTGCCGCGTTTGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148744395_1148744402 4 Left 1148744395 17:49910339-49910361 CCGGTCTCGGGGCCTGCGGTCGG No data
Right 1148744402 17:49910366-49910388 CCGCGGTGCCGCGTTTGAGCCGG No data
1148744400_1148744402 -8 Left 1148744400 17:49910351-49910373 CCTGCGGTCGGGGCACCGCGGTG No data
Right 1148744402 17:49910366-49910388 CCGCGGTGCCGCGTTTGAGCCGG No data
1148744393_1148744402 10 Left 1148744393 17:49910333-49910355 CCGTCTCCGGTCTCGGGGCCTGC No data
Right 1148744402 17:49910366-49910388 CCGCGGTGCCGCGTTTGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148744402 Original CRISPR CCGCGGTGCCGCGTTTGAGC CGG Intergenic
No off target data available for this crispr