ID: 1148745520

View in Genome Browser
Species Human (GRCh38)
Location 17:49915946-49915968
Sequence CTCCCTCGAAGCCCCTCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148745520_1148745527 5 Left 1148745520 17:49915946-49915968 CCAGCGGAGGGGCTTCGAGGGAG No data
Right 1148745527 17:49915974-49915996 CCCATCTAGGTGGGTGTTCAGGG No data
1148745520_1148745523 -5 Left 1148745520 17:49915946-49915968 CCAGCGGAGGGGCTTCGAGGGAG No data
Right 1148745523 17:49915964-49915986 GGGAGGAAAGCCCATCTAGGTGG No data
1148745520_1148745525 4 Left 1148745520 17:49915946-49915968 CCAGCGGAGGGGCTTCGAGGGAG No data
Right 1148745525 17:49915973-49915995 GCCCATCTAGGTGGGTGTTCAGG No data
1148745520_1148745524 -4 Left 1148745520 17:49915946-49915968 CCAGCGGAGGGGCTTCGAGGGAG No data
Right 1148745524 17:49915965-49915987 GGAGGAAAGCCCATCTAGGTGGG No data
1148745520_1148745522 -8 Left 1148745520 17:49915946-49915968 CCAGCGGAGGGGCTTCGAGGGAG No data
Right 1148745522 17:49915961-49915983 CGAGGGAGGAAAGCCCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148745520 Original CRISPR CTCCCTCGAAGCCCCTCCGC TGG (reversed) Intergenic
No off target data available for this crispr