ID: 1148746807

View in Genome Browser
Species Human (GRCh38)
Location 17:49922953-49922975
Sequence TTGTGTGTGTACATGTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148746801_1148746807 8 Left 1148746801 17:49922922-49922944 CCCGGCCTGGGAGTGTGATCCCA No data
Right 1148746807 17:49922953-49922975 TTGTGTGTGTACATGTGTCTGGG No data
1148746803_1148746807 3 Left 1148746803 17:49922927-49922949 CCTGGGAGTGTGATCCCAGAAAT No data
Right 1148746807 17:49922953-49922975 TTGTGTGTGTACATGTGTCTGGG No data
1148746800_1148746807 9 Left 1148746800 17:49922921-49922943 CCCCGGCCTGGGAGTGTGATCCC No data
Right 1148746807 17:49922953-49922975 TTGTGTGTGTACATGTGTCTGGG No data
1148746802_1148746807 7 Left 1148746802 17:49922923-49922945 CCGGCCTGGGAGTGTGATCCCAG No data
Right 1148746807 17:49922953-49922975 TTGTGTGTGTACATGTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148746807 Original CRISPR TTGTGTGTGTACATGTGTCT GGG Intergenic
No off target data available for this crispr