ID: 1148751076

View in Genome Browser
Species Human (GRCh38)
Location 17:49946268-49946290
Sequence GAGGGGAGATGCCCTCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148751076_1148751089 25 Left 1148751076 17:49946268-49946290 CCTGGTGGAGGGCATCTCCCCTC No data
Right 1148751089 17:49946316-49946338 TCACACACCTCCCTGCCTCAGGG No data
1148751076_1148751088 24 Left 1148751076 17:49946268-49946290 CCTGGTGGAGGGCATCTCCCCTC No data
Right 1148751088 17:49946315-49946337 CTCACACACCTCCCTGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148751076 Original CRISPR GAGGGGAGATGCCCTCCACC AGG (reversed) Intergenic