ID: 1148754317

View in Genome Browser
Species Human (GRCh38)
Location 17:49964675-49964697
Sequence CTGAGCGCTTTCTCAGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148754317_1148754325 13 Left 1148754317 17:49964675-49964697 CCAATCCCTGAGAAAGCGCTCAG No data
Right 1148754325 17:49964711-49964733 TGAGCGCAAATGGAAGCACAAGG No data
1148754317_1148754330 29 Left 1148754317 17:49964675-49964697 CCAATCCCTGAGAAAGCGCTCAG No data
Right 1148754330 17:49964727-49964749 CACAAGGCCGGGCTGGCCGTGGG No data
1148754317_1148754329 28 Left 1148754317 17:49964675-49964697 CCAATCCCTGAGAAAGCGCTCAG No data
Right 1148754329 17:49964726-49964748 GCACAAGGCCGGGCTGGCCGTGG No data
1148754317_1148754328 22 Left 1148754317 17:49964675-49964697 CCAATCCCTGAGAAAGCGCTCAG No data
Right 1148754328 17:49964720-49964742 ATGGAAGCACAAGGCCGGGCTGG No data
1148754317_1148754324 3 Left 1148754317 17:49964675-49964697 CCAATCCCTGAGAAAGCGCTCAG No data
Right 1148754324 17:49964701-49964723 CTTGCTGAGGTGAGCGCAAATGG No data
1148754317_1148754327 18 Left 1148754317 17:49964675-49964697 CCAATCCCTGAGAAAGCGCTCAG No data
Right 1148754327 17:49964716-49964738 GCAAATGGAAGCACAAGGCCGGG No data
1148754317_1148754323 -10 Left 1148754317 17:49964675-49964697 CCAATCCCTGAGAAAGCGCTCAG No data
Right 1148754323 17:49964688-49964710 AAGCGCTCAGGGGCTTGCTGAGG No data
1148754317_1148754326 17 Left 1148754317 17:49964675-49964697 CCAATCCCTGAGAAAGCGCTCAG No data
Right 1148754326 17:49964715-49964737 CGCAAATGGAAGCACAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148754317 Original CRISPR CTGAGCGCTTTCTCAGGGAT TGG (reversed) Intergenic