ID: 1148754358

View in Genome Browser
Species Human (GRCh38)
Location 17:49964895-49964917
Sequence TAGAGCCCCCGCATTCAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148754358_1148754364 8 Left 1148754358 17:49964895-49964917 CCTCGCTGAATGCGGGGGCTCTA No data
Right 1148754364 17:49964926-49964948 GCGCGGGGCCGAGCTCAGGCAGG No data
1148754358_1148754361 -7 Left 1148754358 17:49964895-49964917 CCTCGCTGAATGCGGGGGCTCTA No data
Right 1148754361 17:49964911-49964933 GGCTCTATCCACAGCGCGCGGGG No data
1148754358_1148754363 4 Left 1148754358 17:49964895-49964917 CCTCGCTGAATGCGGGGGCTCTA No data
Right 1148754363 17:49964922-49964944 CAGCGCGCGGGGCCGAGCTCAGG No data
1148754358_1148754366 13 Left 1148754358 17:49964895-49964917 CCTCGCTGAATGCGGGGGCTCTA No data
Right 1148754366 17:49964931-49964953 GGGCCGAGCTCAGGCAGGCTGGG No data
1148754358_1148754367 14 Left 1148754358 17:49964895-49964917 CCTCGCTGAATGCGGGGGCTCTA No data
Right 1148754367 17:49964932-49964954 GGCCGAGCTCAGGCAGGCTGGGG No data
1148754358_1148754360 -8 Left 1148754358 17:49964895-49964917 CCTCGCTGAATGCGGGGGCTCTA No data
Right 1148754360 17:49964910-49964932 GGGCTCTATCCACAGCGCGCGGG No data
1148754358_1148754365 12 Left 1148754358 17:49964895-49964917 CCTCGCTGAATGCGGGGGCTCTA No data
Right 1148754365 17:49964930-49964952 GGGGCCGAGCTCAGGCAGGCTGG No data
1148754358_1148754359 -9 Left 1148754358 17:49964895-49964917 CCTCGCTGAATGCGGGGGCTCTA No data
Right 1148754359 17:49964909-49964931 GGGGCTCTATCCACAGCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148754358 Original CRISPR TAGAGCCCCCGCATTCAGCG AGG (reversed) Intergenic
No off target data available for this crispr