ID: 1148754362

View in Genome Browser
Species Human (GRCh38)
Location 17:49964919-49964941
Sequence GAGCTCGGCCCCGCGCGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148754362_1148754367 -10 Left 1148754362 17:49964919-49964941 CCACAGCGCGCGGGGCCGAGCTC No data
Right 1148754367 17:49964932-49964954 GGCCGAGCTCAGGCAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148754362 Original CRISPR GAGCTCGGCCCCGCGCGCTG TGG (reversed) Intergenic
No off target data available for this crispr