ID: 1148754367

View in Genome Browser
Species Human (GRCh38)
Location 17:49964932-49964954
Sequence GGCCGAGCTCAGGCAGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148754351_1148754367 27 Left 1148754351 17:49964882-49964904 CCCATTCTCCGGGCCTCGCTGAA No data
Right 1148754367 17:49964932-49964954 GGCCGAGCTCAGGCAGGCTGGGG No data
1148754352_1148754367 26 Left 1148754352 17:49964883-49964905 CCATTCTCCGGGCCTCGCTGAAT No data
Right 1148754367 17:49964932-49964954 GGCCGAGCTCAGGCAGGCTGGGG No data
1148754362_1148754367 -10 Left 1148754362 17:49964919-49964941 CCACAGCGCGCGGGGCCGAGCTC No data
Right 1148754367 17:49964932-49964954 GGCCGAGCTCAGGCAGGCTGGGG No data
1148754358_1148754367 14 Left 1148754358 17:49964895-49964917 CCTCGCTGAATGCGGGGGCTCTA No data
Right 1148754367 17:49964932-49964954 GGCCGAGCTCAGGCAGGCTGGGG No data
1148754356_1148754367 19 Left 1148754356 17:49964890-49964912 CCGGGCCTCGCTGAATGCGGGGG No data
Right 1148754367 17:49964932-49964954 GGCCGAGCTCAGGCAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148754367 Original CRISPR GGCCGAGCTCAGGCAGGCTG GGG Intergenic
No off target data available for this crispr