ID: 1148754729

View in Genome Browser
Species Human (GRCh38)
Location 17:49967093-49967115
Sequence CTGTTGGACGAGAGGGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148754719_1148754729 21 Left 1148754719 17:49967049-49967071 CCACATAGAATAAGCATTTCTCT No data
Right 1148754729 17:49967093-49967115 CTGTTGGACGAGAGGGGAGTGGG No data
1148754718_1148754729 22 Left 1148754718 17:49967048-49967070 CCCACATAGAATAAGCATTTCTC No data
Right 1148754729 17:49967093-49967115 CTGTTGGACGAGAGGGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148754729 Original CRISPR CTGTTGGACGAGAGGGGAGT GGG Intergenic
No off target data available for this crispr