ID: 1148755763

View in Genome Browser
Species Human (GRCh38)
Location 17:49972211-49972233
Sequence TCTGGCCCGCCTAGCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755763_1148755772 19 Left 1148755763 17:49972211-49972233 CCTGGAGAGCTAGGCGGGCCAGA 0: 1
1: 0
2: 4
3: 10
4: 143
Right 1148755772 17:49972253-49972275 GCGGCACCGCAGCGCGATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1148755763_1148755765 -3 Left 1148755763 17:49972211-49972233 CCTGGAGAGCTAGGCGGGCCAGA 0: 1
1: 0
2: 4
3: 10
4: 143
Right 1148755765 17:49972231-49972253 AGAGCTGACCAGATCCCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 136
1148755763_1148755773 24 Left 1148755763 17:49972211-49972233 CCTGGAGAGCTAGGCGGGCCAGA 0: 1
1: 0
2: 4
3: 10
4: 143
Right 1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1148755763_1148755766 0 Left 1148755763 17:49972211-49972233 CCTGGAGAGCTAGGCGGGCCAGA 0: 1
1: 0
2: 4
3: 10
4: 143
Right 1148755766 17:49972234-49972256 GCTGACCAGATCCCCCGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755763 Original CRISPR TCTGGCCCGCCTAGCTCTCC AGG (reversed) Intronic
900269061 1:1778042-1778064 GCTGTCCGGCCTGGCTCTCCCGG - Intronic
901317146 1:8316966-8316988 GCTGGCCCCCCTAGCTCCTCAGG + Intergenic
904378093 1:30094392-30094414 TATGGCCAGGCCAGCTCTCCAGG - Intergenic
904598781 1:31662612-31662634 TCAGGCCTGCCTGGCTCCCCTGG - Exonic
908484213 1:64574284-64574306 TCTGCTCCGCCTAGCTCCCAGGG + Intronic
911861945 1:102962696-102962718 CCTGGCCCTCCTGGCCCTCCTGG - Exonic
924029342 1:239870466-239870488 GCTGGCCTGTCTAGCGCTCCCGG - Intronic
1063538375 10:6907944-6907966 TCTGCCCTGCCTGTCTCTCCAGG + Intergenic
1066663954 10:37764072-37764094 TCTGTTCCGCCTGGCTCTCAGGG - Intergenic
1070721586 10:78760834-78760856 TCTGGCTGGCCTAGCTCTCTTGG + Intergenic
1070895768 10:79982119-79982141 TCCCGCCCTCCTGGCTCTCCGGG + Intronic
1071573673 10:86711339-86711361 TCCGGCCCGTCTCGCTCGCCTGG - Intronic
1073076567 10:100828369-100828391 CCTGGCCTGCCTAGTTCCCCAGG + Exonic
1075437617 10:122457282-122457304 TCTTGCCCTCCTTTCTCTCCCGG + Exonic
1076121690 10:127941413-127941435 TCAGGCCCACCTGGCTCCCCTGG - Intronic
1076367569 10:129932005-129932027 TCTGGCTGGCCTAGCTCTCCAGG - Intronic
1076626554 10:131824634-131824656 TCTGGCCCGCACAGGTCTCTGGG - Intergenic
1080641586 11:34161499-34161521 TCTGGCCATCCAAGCCCTCCTGG - Intronic
1080845177 11:36020733-36020755 CCTGGCCAGCCCACCTCTCCAGG - Intronic
1083713721 11:64564061-64564083 TCTGGCTCGCCTGGCTGCCCGGG - Intronic
1084438963 11:69159901-69159923 GCTGGCCCTCCTAGCTCTGTCGG - Intergenic
1096197313 12:49657004-49657026 TGATGCCCTCCTAGCTCTCCTGG + Intronic
1096600651 12:52726235-52726257 CCTGGCCCCCTGAGCTCTCCTGG + Intergenic
1101917908 12:108910476-108910498 TCTGGACAGCTGAGCTCTCCTGG - Intergenic
1102953812 12:117046740-117046762 TCTGGCCCGCCCGGGGCTCCTGG - Intronic
1104931474 12:132341527-132341549 TCTGGCCCGCACAGCTGTCGTGG - Intergenic
1106242127 13:27920729-27920751 TCTTTCCCACCCAGCTCTCCTGG + Intronic
1111531349 13:89541469-89541491 TCTGGGCCGCAGAGCTCTCTTGG + Intergenic
1114645920 14:24256077-24256099 TCTGTCCCGCCTCACTCTCTAGG - Exonic
1115516425 14:34189809-34189831 TCAGGCCTGCCTATCTTTCCTGG + Intronic
1118627855 14:67675126-67675148 CCTGGCCCGGCTATCTTTCCAGG - Intronic
1118891286 14:69911309-69911331 TCTGGGCCACATGGCTCTCCTGG - Intronic
1119484627 14:74979563-74979585 TCTGCCCAGCCTAGGCCTCCAGG - Intergenic
1121044504 14:90778099-90778121 CCTGGCCCACCAGGCTCTCCAGG + Intronic
1121751863 14:96363751-96363773 TCTGGCCGGCCTGGCTCTCCCGG + Exonic
1122124953 14:99573859-99573881 TCTGGGCCGCCGAGCACTCCAGG + Intronic
1122664098 14:103316879-103316901 TCTGGCACGCCTCCCACTCCAGG + Intergenic
1123996057 15:25718740-25718762 TCTGTCCTGCCTCCCTCTCCCGG - Intronic
1128764795 15:70244480-70244502 TCTGGCCTGGCCAGATCTCCAGG - Intergenic
1129169950 15:73801566-73801588 TCTGGCCTGCCTAGCACCTCTGG - Intergenic
1129857973 15:78838389-78838411 TCTGGCCTACCTGGCTCCCCCGG + Intronic
1131734061 15:95313502-95313524 TCTGGCCCACCTTCCTTTCCAGG + Intergenic
1131827750 15:96333871-96333893 TCTGGCCCTCAGAGCTCGCCTGG + Intronic
1132514310 16:359229-359251 TCTGGGCCGCCTGGCTGGCCAGG - Intergenic
1132621460 16:870070-870092 CCTGGCCTGCCTCGGTCTCCCGG - Intronic
1136624720 16:31455236-31455258 TCTGGCCTGCCTCGCTGTTCTGG + Intergenic
1139515857 16:67451978-67452000 TCTGGCCAGCCTAGCTGGCAAGG + Intronic
1139927845 16:70501213-70501235 GATGGCCCTCCTAGCTCTGCTGG + Intronic
1140245320 16:73243074-73243096 TCTGGACCACTCAGCTCTCCTGG - Intergenic
1141912141 16:87067313-87067335 TCTCCCCCGCCCACCTCTCCGGG + Intergenic
1142162622 16:88566523-88566545 TCTGGGCAGCCCAGCTCTGCAGG + Intergenic
1143057327 17:4172038-4172060 TGTGGCCCTCCTAGCTTTTCCGG - Intronic
1143492553 17:7292857-7292879 CCTGCCCGGCCTGGCTCTCCTGG - Intronic
1144656944 17:17042785-17042807 CCTGGCCGGCCTGGCGCTCCCGG - Exonic
1144953976 17:19009987-19010009 TCTGGCACCCCAGGCTCTCCTGG - Intronic
1147705545 17:42422695-42422717 TCTGCCCCGCCTGGCGCTCCAGG + Exonic
1148755763 17:49972211-49972233 TCTGGCCCGCCTAGCTCTCCAGG - Intronic
1149404078 17:56329189-56329211 TCTGGCCCTGCTACCTCTTCAGG + Intronic
1150135010 17:62690700-62690722 TCTGGCCCTCATAGCTCTGCAGG - Exonic
1151387627 17:73764739-73764761 TTTGTCCTGCCTAGCTATCCTGG - Intergenic
1151403750 17:73873505-73873527 GCAATCCCGCCTAGCTCTCCTGG - Intergenic
1151745590 17:76010102-76010124 GCTGGGCCGCCTGGCTGTCCAGG + Exonic
1156745749 18:40389163-40389185 TCTGACCCACCTTGCTCTCATGG - Intergenic
1160008399 18:75085617-75085639 TCTGGACAGCCTAGCACACCGGG - Intergenic
1160704611 19:524200-524222 CCTGCCCCGCCCAGCTCCCCGGG + Intergenic
1160792135 19:927751-927773 TCCGGACCGCCAGGCTCTCCTGG + Intronic
1161306793 19:3573170-3573192 TCCGGCCCCCCCAGCGCTCCGGG + Intronic
1161577241 19:5061104-5061126 GGTGGCCCGCCCTGCTCTCCTGG - Intronic
1162513851 19:11136675-11136697 TCTTCCCCGCCTCGCTCTGCTGG - Intronic
1163810471 19:19428548-19428570 TCTGCCCAGCCTGGCTCACCTGG - Intronic
1165157764 19:33798120-33798142 GGTGGCCCGCCTGCCTCTCCGGG + Intronic
1165422668 19:35730113-35730135 TCTGGCCCACCTTGCCATCCAGG - Exonic
1168296010 19:55377615-55377637 CCTGGCCCCCACAGCTCTCCCGG - Exonic
925148120 2:1594621-1594643 TCTGGCCCGCCTCCCTCCCACGG + Intergenic
925262310 2:2539513-2539535 TGTGCCCCTCCCAGCTCTCCTGG + Intergenic
926733962 2:16058424-16058446 GCTGGCCCCACTTGCTCTCCAGG + Intergenic
929556271 2:42927464-42927486 TCTGGCCTCCCTACCTCTCCAGG - Intergenic
932326401 2:70864809-70864831 TCGGGCTCTCCCAGCTCTCCAGG + Intergenic
932912816 2:75822253-75822275 TCTAGCACGCATTGCTCTCCTGG - Intergenic
933021964 2:77205556-77205578 TCTGGCCTCCGTAGCTCTCCTGG - Intronic
934991377 2:98924316-98924338 TCTGCCCCACCTTGGTCTCCTGG + Intronic
938374657 2:130797675-130797697 TGTGGCCCGCCCTGCGCTCCCGG - Intergenic
943527809 2:189039526-189039548 CCTGGCCCACCTGGCCCTCCGGG - Exonic
948496218 2:238351501-238351523 TCTGTCCCGCCTTGCTCTCCAGG - Intronic
948525978 2:238571066-238571088 GCTGGCCCGCCCAGCTCTGCCGG + Intergenic
948881042 2:240857332-240857354 ACTGGCCTGCCTTGCCCTCCTGG - Intergenic
1174379846 20:50149461-50149483 TCTGGCCTGCCAAGCTGGCCAGG + Intronic
1175546024 20:59778333-59778355 TGTGGCCTGCCTCCCTCTCCCGG + Intronic
1175803419 20:61813916-61813938 CCTGGCCCACCTTGCTCACCAGG + Intronic
1180050601 21:45329410-45329432 CCTGTCCCTCCCAGCTCTCCTGG + Intergenic
1180235801 21:46458813-46458835 TCGGGCCCGCGCAGCCCTCCCGG - Intergenic
1180842812 22:18967198-18967220 CATGGCACGCCTATCTCTCCAGG + Intergenic
1181058639 22:20271536-20271558 CATGGCACGCCTATCTCTCCAGG - Intronic
1181174959 22:21030063-21030085 TCTTCCCCGCCCAGCTCCCCAGG - Exonic
1181541163 22:23574018-23574040 CCTGGCCCACTCAGCTCTCCTGG + Intronic
1181551064 22:23639375-23639397 CCTGGCCCACTCAGCTCTCCTGG + Intergenic
1181797216 22:25319312-25319334 CCTGGCCCACTCAGCTCTCCTGG - Intergenic
1182483720 22:30626748-30626770 TCTGGCCAGCCTGGCCCTGCAGG + Exonic
1183454998 22:37917807-37917829 CCTGGCCCTCCCACCTCTCCAGG - Intronic
1183930063 22:41230790-41230812 TCTGCTCCTCCTAGCTCCCCAGG + Exonic
1184197462 22:42939775-42939797 CCTGGCCAGCCTAGTTCTCAGGG + Intronic
1184459809 22:44630801-44630823 TAGGGCCCTTCTAGCTCTCCTGG + Intergenic
1184770622 22:46594684-46594706 TCCGGCCCTCCTAGCCCCCCAGG - Intronic
949844789 3:8358322-8358344 TCTGGCCCTCCCAGCCCACCAGG + Intergenic
950261501 3:11545677-11545699 CCTGCCAGGCCTAGCTCTCCTGG + Intronic
953216525 3:40923821-40923843 TGAGGCCAGCCTAGCTCACCAGG + Intergenic
958169351 3:89918403-89918425 CCTGGGAGGCCTAGCTCTCCAGG + Intergenic
961085398 3:124063098-124063120 TCTGCCTCTCCAAGCTCTCCTGG - Intergenic
963285349 3:143429877-143429899 TAAGGCCCTCCTTGCTCTCCTGG - Intronic
964704150 3:159601006-159601028 ACTGGCCCACCTGGCTTTCCAGG - Intronic
969405565 4:6989266-6989288 TCTGGCTCTCCTCTCTCTCCTGG + Intronic
969612000 4:8232634-8232656 TGTGGCCCACTTGGCTCTCCTGG + Intronic
995365679 5:111357360-111357382 TCTGGCTCTCTCAGCTCTCCTGG - Intronic
998215992 5:140239075-140239097 CCTTTCCCGCCTAGCTCTCTTGG + Intronic
1000450369 5:161378923-161378945 AATGGCTTGCCTAGCTCTCCTGG - Intronic
1000579291 5:163015425-163015447 TTTGGTCCGCCTAGCTCTTCTGG - Intergenic
1002401320 5:178992991-178993013 TGTGGTCCTCCCAGCTCTCCTGG + Intronic
1005132347 6:22523911-22523933 TCTGTTCCGCCCAGCTCACCAGG - Intergenic
1006166666 6:32069499-32069521 TCCTTCCCGCCTGGCTCTCCTGG - Intronic
1006300499 6:33191486-33191508 TCTGGCCAGCCAGGCTCCCCTGG - Intronic
1006380344 6:33693675-33693697 TCTGGGCCACGTAGCTCTCAGGG - Exonic
1007210997 6:40193277-40193299 TCTGGCCTCCTTGGCTCTCCAGG - Intergenic
1011044596 6:83067737-83067759 TCTCGCCGGCGCAGCTCTCCTGG - Exonic
1014372408 6:120626875-120626897 TCAGGCCCACCTAGGTCTGCAGG - Intergenic
1016035028 6:139375413-139375435 TCGGGCCCGCCTGCCGCTCCCGG + Intergenic
1018474817 6:164130054-164130076 TCTGGCCCCTCTGGCCCTCCAGG - Intergenic
1019629145 7:2037356-2037378 CCAGGCACGCCTTGCTCTCCTGG + Intronic
1020027737 7:4911075-4911097 TCTGGCCTCCCCAGCACTCCTGG - Intronic
1020339683 7:7096284-7096306 TCTGGCACTGCTAGCTCACCTGG - Intergenic
1022673278 7:32475892-32475914 TCTGGCATGCCTAGCTCCACGGG - Intergenic
1024995185 7:55268760-55268782 TCTGGCCCTCCTGCCTCTCCTGG - Intergenic
1029425923 7:100493945-100493967 GCGGGCACGCCTGGCTCTCCCGG + Exonic
1031935018 7:127727227-127727249 CCTGGCCCGCCTGGCTCTCCAGG + Intronic
1032423738 7:131803533-131803555 TCTGGCCCTCCTCCTTCTCCTGG - Intergenic
1034418170 7:150976002-150976024 ACTCGCCAGCCTGGCTCTCCGGG - Intronic
1035173180 7:157032061-157032083 GCTGGCTCACCTCGCTCTCCTGG + Intergenic
1036791987 8:11727036-11727058 GCTGGCACGCACAGCTCTCCTGG - Intronic
1038508777 8:28110377-28110399 TCTGGCACGGATAGCTCTCATGG - Exonic
1039452941 8:37690273-37690295 TCTCCCCGGCCTAGCTCCCCAGG + Intergenic
1041933522 8:63312133-63312155 TCTGTCCCAGCTAACTCTCCTGG + Intergenic
1043867907 8:85396560-85396582 TTTGGCTCTCCTGGCTCTCCTGG - Intronic
1044502547 8:92975026-92975048 TCTGGCAGGCCTGGCTCTCAGGG + Intronic
1044586020 8:93869780-93869802 TCTGGCCAGCCCAGCCCTGCCGG + Intronic
1046984176 8:120369359-120369381 CCTGGGCCCCCTGGCTCTCCTGG + Exonic
1049291053 8:141802168-141802190 TCTGCCCAGCCTAACTCCCCGGG - Intergenic
1049468477 8:142764495-142764517 ACTGGCCAGCCCACCTCTCCCGG - Exonic
1049986723 9:958615-958637 CCTGGACCTCCTAACTCTCCGGG + Intronic
1050399152 9:5232065-5232087 TCTGGCCTGCCCAGCTTTCCTGG - Intronic
1051611931 9:18969781-18969803 TCTGCCCTGCTTAGCTCTCAGGG - Intronic
1052916392 9:33926947-33926969 CCTGGCCTGCCCAGCTCCCCTGG - Intronic
1060849355 9:126861155-126861177 CCTGGCCCGGCCGGCTCTCCAGG - Intronic
1061513876 9:131077190-131077212 TCTGGGCCGCCTGGACCTCCTGG - Exonic
1061558167 9:131384932-131384954 TCTCTCCAGCCTTGCTCTCCTGG - Intergenic
1062190772 9:135246820-135246842 TGTGGCCCGCACACCTCTCCTGG - Intergenic
1062324178 9:136004525-136004547 TCTGGCCAGCCTACCCCTCACGG + Intergenic
1192174395 X:68876817-68876839 TCTGGCTTGCCTCCCTCTCCAGG + Intergenic
1196824720 X:119732083-119732105 TCTGGGACACCCAGCTCTCCTGG - Intergenic
1199850915 X:151724553-151724575 CCTGGCCCTCTTGGCTCTCCTGG - Intergenic