ID: 1148755764

View in Genome Browser
Species Human (GRCh38)
Location 17:49972229-49972251
Sequence GCGGGGGATCTGGTCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755764_1148755776 16 Left 1148755764 17:49972229-49972251 CCAGAGCTGACCAGATCCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1148755764_1148755773 6 Left 1148755764 17:49972229-49972251 CCAGAGCTGACCAGATCCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1148755764_1148755772 1 Left 1148755764 17:49972229-49972251 CCAGAGCTGACCAGATCCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1148755772 17:49972253-49972275 GCGGCACCGCAGCGCGATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1148755764_1148755775 15 Left 1148755764 17:49972229-49972251 CCAGAGCTGACCAGATCCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755764 Original CRISPR GCGGGGGATCTGGTCAGCTC TGG (reversed) Intronic
900074725 1:804145-804167 GCGAGGGAACTGGTGAGCTCAGG - Intergenic
901010560 1:6199411-6199433 GCAGGGGCTCTGGCCCGCTCCGG + Intronic
904031222 1:27534587-27534609 GCAGGGGCTCTGGACACCTCGGG + Exonic
905129859 1:35746171-35746193 GCGGGGGATTTCCTGAGCTCAGG - Intronic
908053570 1:60259035-60259057 TCGGGGGATCTCTTGAGCTCAGG - Intergenic
908474041 1:64470953-64470975 GCGGGATGTCTGGCCAGCTCGGG - Intronic
913544389 1:119853243-119853265 GCGGGGGAGGTGGAGAGCTCGGG - Intergenic
914244386 1:145874911-145874933 GCGGGGGCTGTGGACAGCACAGG - Exonic
915648453 1:157290438-157290460 GCAGGACATCAGGTCAGCTCTGG + Intergenic
920189701 1:204185636-204185658 GCGGGGGATCTCTTGAGCTCAGG - Intergenic
921586866 1:216957602-216957624 TGAGGGGAACTGGTCAGCTCTGG - Intronic
922270570 1:224029050-224029072 GCGAGGGAACTGGTGAGCTTAGG - Intergenic
922764841 1:228151347-228151369 CCTGGGGGTCTGGTCAGTTCAGG + Intronic
1063167769 10:3479450-3479472 GCGGGGGAACTTGTCACCACAGG - Intergenic
1063450205 10:6145582-6145604 GCGCGGGAGGTGGGCAGCTCTGG + Intronic
1063460738 10:6213631-6213653 GTGGGGGAGTTGGTCAGCTTTGG - Exonic
1070323334 10:75371410-75371432 GAGAGGGATCCAGTCAGCTCTGG - Intergenic
1073632399 10:105161912-105161934 GCAGGGGGTCTGGTTAGCTGTGG - Intronic
1075098554 10:119489906-119489928 ACGGGGGAGCTGGTGAGCTGTGG - Intergenic
1075119322 10:119652197-119652219 GCGGCCGGCCTGGTCAGCTCCGG + Intronic
1075380810 10:122017122-122017144 GAGGCTGCTCTGGTCAGCTCCGG - Intronic
1077315338 11:1917202-1917224 CTGGGGGCTCAGGTCAGCTCAGG + Intergenic
1077550752 11:3199195-3199217 CCGGGGCATCTGGCCCGCTCAGG + Intergenic
1083108174 11:60378611-60378633 GCTGGGGATCAGCTCACCTCTGG - Exonic
1089095901 11:115919710-115919732 TTGGGGGATCAGATCAGCTCAGG + Intergenic
1089359102 11:117874657-117874679 GCAGAGGATCAGGCCAGCTCTGG - Intronic
1089777241 11:120846922-120846944 CTGGGGGATCTGGACAGCTGAGG - Intronic
1092002517 12:5044099-5044121 GCGCGGGAGCCGGTCAGCTGGGG + Exonic
1099328728 12:81253609-81253631 TCGGGGGATCTTGCCAGATCTGG - Exonic
1100587545 12:95994112-95994134 ACGGAGGATCTGGTCAACTTGGG - Exonic
1101773821 12:107775744-107775766 GCGGGGGTCCTGGCCAGTTCGGG - Exonic
1113681900 13:112250390-112250412 GCGTGGGATCTGGACAGCAGAGG + Intergenic
1114457875 14:22868473-22868495 GCGGAGGTTCTGGTGAGCTGAGG + Intergenic
1114658477 14:24330157-24330179 CCGGGCCATCAGGTCAGCTCAGG - Exonic
1119365192 14:74085170-74085192 GCGGGGAAACTGGGCACCTCCGG - Intronic
1121218524 14:92267074-92267096 GCGGGGGATCTCCTGAGCCCAGG - Intergenic
1121226043 14:92322814-92322836 GCGGGGCCTCGGGTCGGCTCGGG + Intronic
1122079678 14:99257962-99257984 GGGGAGGACCTGGTGAGCTCTGG - Intronic
1123411897 15:20067699-20067721 GCTGGGGCTCTGGTGAGGTCAGG - Intergenic
1123521241 15:21074818-21074840 GCTGGGGCTCTGGTGAGGTCAGG - Intergenic
1123578326 15:21694900-21694922 GCTGGGGCTCTGGTGAGGTCAGG - Intergenic
1123614951 15:22137382-22137404 GCTGGGGCTCTGGTGAGGTCAGG - Intergenic
1125723120 15:41854546-41854568 CTGGGGGACCGGGTCAGCTCAGG + Intronic
1125769218 15:42154003-42154025 GAGGGGGCTCTGGTCGGCACAGG - Intronic
1126711489 15:51461777-51461799 GTGGGGGATCTCCTGAGCTCAGG - Intronic
1130132674 15:81157453-81157475 CCAGGGGAACTGCTCAGCTCAGG + Intergenic
1130878220 15:88032472-88032494 GTGGAGGTTCTGGTGAGCTCAGG + Intronic
1202987196 15_KI270727v1_random:429145-429167 GCTGGGGCTCTGGTGAGGTCAGG - Intergenic
1132754035 16:1473855-1473877 GCGGGGGATCACGTGAGGTCGGG + Intronic
1133017952 16:2953564-2953586 GCGGTGGATCTTTTGAGCTCAGG - Intergenic
1136374869 16:29859388-29859410 GAGGGGGATCTGGCCTGCCCAGG - Intronic
1136927506 16:34388574-34388596 GCGGGGGCGGTGGTCAGGTCCGG + Intergenic
1136977068 16:35023232-35023254 GCGGGGGCGGTGGTCAGGTCCGG - Exonic
1139529717 16:67537330-67537352 GCGAGGGGTCTGCTCAGCTGGGG - Intronic
1142673642 17:1499756-1499778 GCGGGGGAGCAGGACAGCTGCGG + Intronic
1143644915 17:8223827-8223849 GCTGGGACTCTGGGCAGCTCCGG - Intergenic
1143673510 17:8413229-8413251 GCCGTGGATCTGATCAGCTGAGG + Intronic
1143868468 17:9940954-9940976 GCCTGGGCTCTGGCCAGCTCTGG - Intronic
1145197616 17:20908566-20908588 GCAGGGGATCTGGAAAGCACTGG + Intergenic
1145787473 17:27603562-27603584 GCAGGGGATCTGGGCAGGTGGGG - Intronic
1146353141 17:32112643-32112665 GCCGGCGATCTGGTCCCCTCGGG + Intergenic
1147987592 17:44315360-44315382 GCGGGGGATCCGGGCATCCCGGG + Intronic
1148011427 17:44485040-44485062 GCGGGCGATCTCTTGAGCTCAGG - Intronic
1148342077 17:46879239-46879261 GTGGGGGACCCGGTCAGGTCAGG - Intronic
1148755764 17:49972229-49972251 GCGGGGGATCTGGTCAGCTCTGG - Intronic
1148966539 17:51440624-51440646 GCGGGGGATTTGGTAATGTCTGG + Intergenic
1151473280 17:74331128-74331150 GTGGGGGAACTGGTCAGGTCGGG - Intronic
1151988112 17:77557000-77557022 GCGTGTGTTCTGGTCAGCACAGG + Intergenic
1152474813 17:80510988-80511010 GCTGGGCCTCTGGACAGCTCAGG - Intergenic
1152808439 17:82369979-82370001 TCGGGGGAGCTGGCAAGCTCAGG + Intergenic
1153458024 18:5299625-5299647 GTGGGGCATCTGGTCGTCTCTGG + Intergenic
1154434686 18:14334683-14334705 CAGGGGCATCTGGTCACCTCAGG + Intergenic
1160983883 19:1828586-1828608 GCGGGGGGCTTGGGCAGCTCAGG + Exonic
1162261159 19:9535306-9535328 GTGGGGATTATGGTCAGCTCGGG - Intronic
1164608817 19:29618537-29618559 GAAGGGGAACTGGGCAGCTCAGG - Intergenic
1165132523 19:33641650-33641672 GAGGGGGTTCTGGACAGCCCAGG + Intronic
1165321222 19:35086528-35086550 TCGGGGGGCCAGGTCAGCTCTGG - Intergenic
1165944883 19:39436052-39436074 GCGGGGCGTCTGGTCAGCGGCGG + Intergenic
1166228545 19:41412110-41412132 GCTGGGGCTCTGGGCAGCCCTGG - Intronic
1166399133 19:42465039-42465061 GCGGGGGATCTCTTGAGGTCAGG + Intergenic
1166810057 19:45509072-45509094 GCGGGGGATGTGGGCACCACGGG - Intronic
926083571 2:10007283-10007305 GCGGGAGATCTCCTGAGCTCAGG - Intergenic
929863293 2:45697312-45697334 ATGGGGGATCTGGAGAGCTCTGG + Intronic
930005377 2:46892268-46892290 GCAGGGGAGGTGGTCAGCTGTGG + Intergenic
930360150 2:50367605-50367627 GATGGGGATCTGCCCAGCTCAGG - Intronic
936556868 2:113503763-113503785 GCGGCGGAGTTGGGCAGCTCCGG + Intergenic
937225000 2:120363672-120363694 TGGGGGGATCTGGACAGGTCTGG + Intergenic
938279362 2:130053340-130053362 CAGGGGCATCTGGTCACCTCAGG - Intergenic
938330312 2:130444054-130444076 CAGGGGCATCTGGTCACCTCAGG - Intergenic
938436030 2:131284095-131284117 CAGGGGCATCTGGTCACCTCAGG + Intronic
947095425 2:226561594-226561616 GGGGAGGATCTGGTCACCTGAGG + Intergenic
948202732 2:236141682-236141704 GGGGGAGATGTGGTCAACTCTGG - Intergenic
1170072139 20:12380736-12380758 GCGGATGTTCTCGTCAGCTCAGG + Intergenic
1171883100 20:30632264-30632286 CAGGGGCATCTGGTCACCTCAGG - Intergenic
1172752113 20:37258311-37258333 GCGGGGGTGCTGGCCACCTCCGG - Intronic
1175702395 20:61149351-61149373 GAGGACGATCTGTTCAGCTCCGG - Intergenic
1176022964 20:62971393-62971415 GCAGGGGCTCTGGCCAGCTGGGG + Intergenic
1176115371 20:63429759-63429781 GAGGGGCTTCTGGACAGCTCTGG - Intronic
1176842345 21:13851023-13851045 CAGGGGCATCTGGTCACCTCAGG - Intergenic
1178626514 21:34223129-34223151 GCACGGGACCTGGTCAGCCCTGG + Intergenic
1178924261 21:36761869-36761891 GCGGAGGAGCTTGACAGCTCTGG - Intronic
1178939675 21:36894583-36894605 GCAGGGCATCTGGTAAGCTAAGG + Intronic
1179547208 21:42120828-42120850 GAGGGGGATCTGGGCAGAGCAGG - Intronic
1179802285 21:43816658-43816680 GCTGGGGCTGTGGCCAGCTCCGG - Intergenic
1181558091 22:23683658-23683680 ACTGGGGATCTGGTCCACTCTGG + Intergenic
1182788542 22:32929053-32929075 CCGGGGGATCTCCTCAGGTCAGG + Intronic
1183954431 22:41370851-41370873 GTCTGGGAGCTGGTCAGCTCTGG - Intronic
1184128040 22:42501324-42501346 GCGGGGGCGCTGGTCAGGCCTGG - Intergenic
1184136831 22:42554637-42554659 GCGGGGGCGCTGGTCAGGCCTGG - Intronic
954131450 3:48563161-48563183 GCAGGGGCTCTGGTCAACTGGGG + Intronic
969245296 4:5927967-5927989 GCGGTGGAGCTTGTCAACTCAGG - Intronic
970345846 4:15151208-15151230 GAGGGCCATGTGGTCAGCTCTGG + Intergenic
970698545 4:18707993-18708015 GGGGGCGAACTGGTCCGCTCAGG + Intergenic
973366761 4:49214580-49214602 CAGGGGCATCTGGTCACCTCAGG - Intergenic
976161935 4:82210909-82210931 GCGGGGGATCTATTGAGCCCTGG + Intergenic
978618571 4:110618885-110618907 GCAGGAGACCTGGTCTGCTCTGG + Intronic
986663742 5:10082240-10082262 GAGGGGGAACTGGACATCTCTGG - Intergenic
990519546 5:56565530-56565552 GCGGGGAATCTGCAAAGCTCAGG + Intronic
996234423 5:121108609-121108631 GCCGGGCCTCTGCTCAGCTCTGG + Intergenic
1001701915 5:173712920-173712942 GCGGGGGATGGGGACAGGTCAGG - Intergenic
1002443351 5:179275484-179275506 GGGTGTGATCAGGTCAGCTCTGG + Intronic
1004480959 6:16018923-16018945 GTGGAGGATCTGGTCAGCAGGGG - Intergenic
1006922800 6:37637487-37637509 GCCAGGGCTCTGGTCAGCTCTGG + Intronic
1008511463 6:52279486-52279508 GCGGGGGAGCTGGCCGGCTGGGG + Exonic
1013226703 6:108124169-108124191 GCTGGGCATCTGCTCAGCCCGGG - Intronic
1019381945 7:728311-728333 GTGAGGGATCTGGCCAGCTCAGG + Intronic
1021716990 7:23469768-23469790 GCCGGGGCTCTCCTCAGCTCCGG - Intronic
1025218141 7:57077495-57077517 TGGGGGGATCTTTTCAGCTCAGG + Intergenic
1025629054 7:63251112-63251134 TGGGGGGATCTTTTCAGCTCAGG + Intergenic
1025653204 7:63492958-63492980 TGGGGGGATCTTTTCAGCTCAGG - Intergenic
1031498901 7:122487235-122487257 GGGGGGGATCTCTTCAGTTCAGG - Intronic
1033370459 7:140702909-140702931 ACCTGGGATCTGGTCAGCTGGGG - Exonic
1035540916 8:437334-437356 GCGAGGGAACTGGTGAGCTCAGG + Intronic
1037688913 8:21166544-21166566 CAGTGGGAACTGGTCAGCTCTGG - Intergenic
1038666744 8:29543923-29543945 TGGGGAGATCAGGTCAGCTCAGG - Intergenic
1046633569 8:116646546-116646568 GCGGGGGTTCTCCTCGGCTCTGG + Exonic
1049038956 8:140098268-140098290 GCGGAGGATCTGGGTGGCTCTGG - Intronic
1049896137 9:113548-113570 GCGGCGGAGTTGGGCAGCTCCGG - Intergenic
1052769025 9:32670594-32670616 GTGGGAGATCTGCTGAGCTCAGG + Intergenic
1053666614 9:40322067-40322089 TCGGGGCATCTGGTCACCGCAGG + Intronic
1053739273 9:41123726-41123748 GCGGCGGAGGTGGGCAGCTCCGG - Intergenic
1054377766 9:64462095-64462117 TCGGGGCATCTGGTCACCGCAGG + Intergenic
1054517995 9:66054216-66054238 TCGGGGCATCTGGTCACCTCAGG - Intergenic
1054689077 9:68307596-68307618 GCGGCGGAGGTGGGCAGCTCCGG + Intergenic
1060388421 9:123256244-123256266 GCGGAGGATCAGTTGAGCTCAGG - Intronic
1062439455 9:136563240-136563262 GCGGGGGCTCAGGGGAGCTCAGG - Intergenic
1190403924 X:50067419-50067441 GCGGGCAGTCGGGTCAGCTCAGG - Intronic
1192142593 X:68658649-68658671 GCTGGGGACCTGGGAAGCTCTGG + Intronic
1192181181 X:68916668-68916690 GCTGGGGCTCTGGCCTGCTCAGG + Intergenic
1195747879 X:108136955-108136977 GCTGGTGTTCAGGTCAGCTCTGG - Intronic