ID: 1148755767

View in Genome Browser
Species Human (GRCh38)
Location 17:49972239-49972261
Sequence CGGTGCCGCCGCGGGGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755767_1148755775 5 Left 1148755767 17:49972239-49972261 CCAGATCCCCCGCGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148755767_1148755772 -9 Left 1148755767 17:49972239-49972261 CCAGATCCCCCGCGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1148755772 17:49972253-49972275 GCGGCACCGCAGCGCGATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1148755767_1148755773 -4 Left 1148755767 17:49972239-49972261 CCAGATCCCCCGCGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1148755767_1148755776 6 Left 1148755767 17:49972239-49972261 CCAGATCCCCCGCGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1148755767_1148755782 25 Left 1148755767 17:49972239-49972261 CCAGATCCCCCGCGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755767 Original CRISPR CGGTGCCGCCGCGGGGGATC TGG (reversed) Intronic