ID: 1148755768

View in Genome Browser
Species Human (GRCh38)
Location 17:49972245-49972267
Sequence GCGCTGCGGTGCCGCCGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755768_1148755775 -1 Left 1148755768 17:49972245-49972267 CCCCCGCGGCGGCACCGCAGCGC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148755768_1148755782 19 Left 1148755768 17:49972245-49972267 CCCCCGCGGCGGCACCGCAGCGC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1148755768_1148755776 0 Left 1148755768 17:49972245-49972267 CCCCCGCGGCGGCACCGCAGCGC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1148755768_1148755773 -10 Left 1148755768 17:49972245-49972267 CCCCCGCGGCGGCACCGCAGCGC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1148755768_1148755783 26 Left 1148755768 17:49972245-49972267 CCCCCGCGGCGGCACCGCAGCGC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1148755783 17:49972294-49972316 CGCTGCGCGCTCTTGGAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1148755768_1148755784 27 Left 1148755768 17:49972245-49972267 CCCCCGCGGCGGCACCGCAGCGC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1148755784 17:49972295-49972317 GCTGCGCGCTCTTGGAACCCGGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755768 Original CRISPR GCGCTGCGGTGCCGCCGCGG GGG (reversed) Intronic
903907535 1:26696950-26696972 GCGCTGCAGAGCGGCGGCGGCGG + Exonic
905414384 1:37794393-37794415 GCGGTGCGGGGCGGCGGCGGCGG - Exonic
906365533 1:45206439-45206461 GCCCAGCGGTGGCGCCGAGGGGG + Exonic
906640673 1:47438864-47438886 GCGTGGCGGGGCCGCGGCGGCGG + Exonic
910679087 1:89843982-89844004 GCGCTGCGGAGCCGCCTGCGAGG + Intronic
910758984 1:90717498-90717520 GCGCGGCGGTGGCGGCGCGGAGG + Intergenic
912514838 1:110211013-110211035 CTGCTGCGCTGCCGCCGCTGCGG + Intergenic
915302973 1:154961992-154962014 GGGCGGTGGAGCCGCCGCGGAGG + Intronic
922315061 1:224434628-224434650 GCGCCGCGGGGCGGCTGCGGGGG + Intronic
922518268 1:226223920-226223942 GCGCTGCGACGCCGACGGGGCGG - Exonic
922526642 1:226309250-226309272 GCGCTGCGCTGCTCCCGCCGCGG + Exonic
1065140462 10:22714416-22714438 GCGCGCCGGGGCCGCCGCCGGGG - Exonic
1068690124 10:59906091-59906113 GCGCTGCGGCGCGTCCCCGGGGG + Intronic
1073071785 10:100798864-100798886 GTCCTGCTGTGCCGCCGTGGGGG + Intronic
1074762101 10:116674889-116674911 GCACTGCGGTGCCCGCCCGGAGG - Exonic
1076849997 10:133088061-133088083 GCGCTGCGCTCCCCCCGCCGGGG - Exonic
1076865532 10:133164596-133164618 GGGCTGCGGGGCTGCCGAGGTGG - Intronic
1077170037 11:1162022-1162044 GCACTGCGGTGCCGCCTACGAGG + Exonic
1078594420 11:12674487-12674509 GGGCGGCGGGGCCGCGGCGGCGG - Intergenic
1083886126 11:65574315-65574337 GCCCTGCCGTCCCGCCGGGGCGG + Intergenic
1083886560 11:65576137-65576159 GCTCTCCGCTGCCGCCGCTGGGG - Exonic
1089842123 11:121427379-121427401 GAGCTGCGCAGCCGCCGCGCCGG + Intergenic
1091286570 11:134411768-134411790 GCGCGGCGGGGCGCCCGCGGGGG + Intronic
1096482453 12:51951701-51951723 GCGCTGCTGGGCTGCGGCGGCGG + Exonic
1096775575 12:53961525-53961547 GGGCTGCTGTGCCCCCGCGAAGG + Intergenic
1097925429 12:65121597-65121619 GCGCTGTGGGGCCCCCCCGGGGG + Intergenic
1098943065 12:76559552-76559574 GCGCTGCCCAGCGGCCGCGGAGG + Exonic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1101253833 12:102958369-102958391 GCTCTGCGCTGCCGCTGCGGCGG - Exonic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1102256430 12:111418198-111418220 GCCCCGCGGGGCCGCCGCCGGGG - Exonic
1102853884 12:116277288-116277310 GCGCCGCGGCGACGCCGCGCCGG + Exonic
1105413838 13:20192798-20192820 GCGCGGCGGGGCCGGGGCGGGGG + Intronic
1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG + Intronic
1113831228 13:113297344-113297366 GCGCTGCGGTGGCGGGGCGCGGG - Exonic
1116817862 14:49599795-49599817 CCGCGGCGCTGCCGCCGCCGCGG - Intronic
1120993249 14:90396957-90396979 GCGAGGCGGCTCCGCCGCGGCGG + Intronic
1122275085 14:100587099-100587121 GCGCTGCGCCCCCGCCGTGGAGG - Intronic
1122486620 14:102086650-102086672 GGGCTGCGGCTCCGCCACGGCGG + Intronic
1122543359 14:102509682-102509704 GCCCTGCGATCCGGCCGCGGCGG - Exonic
1122975308 14:105168477-105168499 GCGCTGGGAGGCCGGCGCGGCGG - Exonic
1123739909 15:23226293-23226315 GCGCTACGAGTCCGCCGCGGTGG - Intergenic
1124291132 15:28455261-28455283 GCGCTACGAGTCCGCCGCGGTGG - Intergenic
1124629397 15:31328039-31328061 GCGCTCGGGTGGGGCCGCGGGGG + Intronic
1126087330 15:45022718-45022740 GCGCTGCAGGGCCGGCGCGGTGG + Intergenic
1126800833 15:52295454-52295476 GGGCCGCGGAGGCGCCGCGGAGG - Intronic
1127606431 15:60592214-60592236 GGGCTCAGGTGGCGCCGCGGCGG + Intronic
1128583026 15:68821510-68821532 GGGCTGCTGGGCAGCCGCGGTGG - Intronic
1129612212 15:77070411-77070433 ACGCTGCGGAGCCGGGGCGGGGG - Intronic
1130348012 15:83066885-83066907 GCGCTGCGGGCCCCCAGCGGCGG + Exonic
1132365129 15:101251576-101251598 GCGCGGCGGGCCCGCGGCGGCGG - Exonic
1137618232 16:49858947-49858969 GCTCTGGGGTGCCCCCGCCGCGG + Intergenic
1138590430 16:57996547-57996569 GCCCTCCGCTGCCGCGGCGGCGG + Exonic
1142395347 16:89828565-89828587 CAGCTGCGGCGGCGCCGCGGCGG + Exonic
1142399181 16:89850435-89850457 CGGCTGCGGTGCCGCCGATGAGG + Exonic
1142795533 17:2303952-2303974 GCGCAGAGGTGCGGCCGGGGAGG + Exonic
1146371112 17:32266054-32266076 GGGCTGCGGAGCGGGCGCGGAGG + Intergenic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1148754941 17:49968595-49968617 GCGGTGGGGTGCAGCGGCGGCGG + Intergenic
1148755768 17:49972245-49972267 GCGCTGCGGTGCCGCCGCGGGGG - Intronic
1149849243 17:60025758-60025780 GCGCGGCGGGGCCTCCGCGAAGG - Intergenic
1149860925 17:60120766-60120788 GCGCGGCGGGGCCTCCGCGAAGG + Intergenic
1152183453 17:78840065-78840087 GCGCTGCGGAGTCGCCCGGGAGG - Intronic
1152222151 17:79074847-79074869 GCGCAGCGCTGACGCCGCGCTGG - Intergenic
1153285152 18:3449993-3450015 GGGCGGCGGTGCGGACGCGGGGG - Intronic
1160795267 19:942421-942443 CCGCTGCGGTGCCGACCTGGTGG + Intronic
1161301173 19:3543886-3543908 GCGCTGGGGTGCCGACAGGGAGG - Exonic
1161333752 19:3700213-3700235 GGGCTGCGGGGCCGGGGCGGGGG - Intronic
1161681182 19:5680636-5680658 GGGCTGCGGTCTCGCAGCGGAGG + Exonic
1162128237 19:8510867-8510889 GCGCGGCGGCCCGGCCGCGGGGG + Exonic
1162535867 19:11262518-11262540 GCGGGGCGGGGCCGGCGCGGGGG + Intergenic
1164658544 19:29942330-29942352 CCGCTGCGGGGCGGCGGCGGCGG + Exonic
1166077200 19:40420775-40420797 GCTCTGCGGTGCCGCCGTCTTGG - Intergenic
1168155384 19:54471382-54471404 GAGCTGCGGTGCAGCCGGGTCGG + Intronic
1168337665 19:55605610-55605632 GCGGTGCGGGGCTGCCGGGGAGG + Intronic
1168594452 19:57664272-57664294 GCGCGGCGATGCCGCAGCTGCGG + Intergenic
927472233 2:23385295-23385317 GCGCTGCGGAGCCGGGGCCGGGG - Exonic
929501227 2:42493468-42493490 GCGCAGCGGGGCGGCCTCGGTGG - Exonic
930096781 2:47571482-47571504 GCGCATCGGTGCCGCAGCCGCGG + Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
935590521 2:104843153-104843175 GCGCGGCGGTAGCGCCCCGGCGG + Intergenic
936400311 2:112159855-112159877 GTGCTGCGCTGCCGCCCCAGCGG - Intronic
938301115 2:130213667-130213689 CCGGGGCGCTGCCGCCGCGGCGG + Intergenic
946354860 2:219178291-219178313 GGGCTGCGCGGCCGCCGCCGGGG - Exonic
946885652 2:224219945-224219967 GCCCTGGGGTGCCGCTGGGGTGG + Intergenic
948958846 2:241316087-241316109 GCTCTGGGGTGCCGGCGGGGCGG + Intronic
1168878813 20:1188977-1188999 GCGCTGGGGTGGCGGGGCGGGGG + Intronic
1171452674 20:25247437-25247459 GGGCTGCGGTCCCTCCGAGGCGG + Intergenic
1172446808 20:34997474-34997496 GCGCCGCAGTGCCGCCACTGTGG - Exonic
1175878590 20:62243446-62243468 GCGCTGCGGGGCAGGCGCTGCGG - Intronic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1179563963 21:42234917-42234939 GCGCCGCCGCTCCGCCGCGGAGG - Intronic
1180009812 21:45041723-45041745 GCCCTGCGGTGCCTGTGCGGAGG + Intergenic
1180650018 22:17369697-17369719 AGGCTGCGGCGCTGCCGCGGCGG + Exonic
1180961372 22:19763847-19763869 CCGCCCCGGTGCCGCTGCGGTGG - Intronic
1183650842 22:39152492-39152514 GAGCTGCGGGGCCGCGGCTGCGG + Exonic
1183893772 22:40951349-40951371 GCGCTGCTGCGCAGGCGCGGTGG + Exonic
1184035051 22:41914280-41914302 GCGCTGCGGTGTCGCGGGCGCGG + Exonic
1184676299 22:46045110-46045132 GCGCTCCGGTGCAGCGGCCGAGG - Intergenic
950710626 3:14810752-14810774 GCCCCGCGGGGCGGCCGCGGAGG + Intergenic
951543611 3:23806051-23806073 GCTCCTCCGTGCCGCCGCGGCGG - Exonic
954004236 3:47578922-47578944 GTGCGGCGGGGCCGGCGCGGCGG - Exonic
954540633 3:51391266-51391288 GCGCGGCGGTGGCGGCGGGGCGG - Exonic
954693767 3:52409882-52409904 GCGCTGAGGGGCCGCCCCGCGGG - Exonic
958470200 3:94507625-94507647 GCGCTGCGGCTCTGCCGCGGCGG - Intergenic
960110313 3:113838876-113838898 GCGGGGCGGTGCCGCGGCGGCGG + Exonic
963335793 3:143972275-143972297 GCGCGGCGGGGGCGCCCCGGGGG + Exonic
968134180 3:196209549-196209571 GCCCTGCGGTCACCCCGCGGCGG + Intronic
968422750 4:499177-499199 GCGCTGCTGTGGCGCGCCGGCGG + Intergenic
970332937 4:15003484-15003506 GCCCCGCGGCGCCGCCACGGAGG + Exonic
984823625 4:183905820-183905842 GAGCAGCGCTGCCGCCGCGCGGG + Exonic
985129020 4:186723592-186723614 GCGCTGCGGTGCGGACTCTGTGG - Intronic
990347449 5:54884129-54884151 GGGACGCGGGGCCGCCGCGGCGG - Intergenic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
997975410 5:138439065-138439087 GCGCTCCGCTGCCCCCGCGGCGG + Exonic
997990803 5:138543133-138543155 CCGCCGCGGAGCCGCCGCCGGGG - Exonic
998199381 5:140107658-140107680 GCGCTCGGCGGCCGCCGCGGCGG + Intergenic
1002089810 5:176797870-176797892 GAGCTGCGGTGTCTCCGCGATGG + Intergenic
1002455947 5:179345423-179345445 GCCCTGCGGTGCTGCAGCTGCGG - Exonic
1003084960 6:3053687-3053709 GCGCTGCGGCTCCGCCCTGGGGG + Intergenic
1016400850 6:143678227-143678249 GCGATGCGCTCCCGCCGCGCGGG + Intronic
1018854105 6:167663134-167663156 GCTCTGCGGGGCCACCGTGGGGG + Intergenic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1029414839 7:100436196-100436218 GGGCTGCCGTGCCGCGGCTGAGG + Exonic
1029547364 7:101217371-101217393 GGGCTGCTGTGCGGCCGCCGCGG + Exonic
1029640522 7:101816714-101816736 GCGCTGTGGTGCCGCCGGCTCGG + Intronic
1029813988 7:103075246-103075268 GCGCTGCGGCTCTGCCGCGGCGG + Exonic
1030121103 7:106111946-106111968 GCGGGGCGGAGACGCCGCGGCGG - Intronic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1031629907 7:124033213-124033235 GCGCAGCGGGGCCACGGCGGGGG - Intergenic
1041673650 8:60516959-60516981 GCGGGGCGGAGGCGCCGCGGCGG + Exonic
1041690372 8:60680356-60680378 GCGGTGCGGGGCGGGCGCGGCGG + Intronic
1042962624 8:74320612-74320634 GCGCTGCGCTGCCACCGGGAGGG - Intronic
1044999700 8:97869022-97869044 GGGAGGCGGTGCCGCGGCGGGGG - Intronic
1047961659 8:130016076-130016098 GCGCAGCGGGGCCGCCGCCCGGG - Intronic
1048214265 8:132480866-132480888 GCGCTCCGGGGCGGCGGCGGCGG + Exonic
1049651224 8:143770960-143770982 GCGCTCCGTTGCAGCCGCGGTGG + Intergenic
1049799363 8:144510623-144510645 GTGCTGCGCTTCCGCCTCGGGGG + Exonic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1054905839 9:70413280-70413302 GCGCTGCGGTGCCGGAGCATGGG - Exonic
1055090979 9:72364784-72364806 GCGCCCTGGTGCCGCCGCCGCGG + Intronic
1059125761 9:111683195-111683217 GGGCTGTGGTGCAGGCGCGGTGG - Intergenic
1060484989 9:124041123-124041145 GGGCTGCAGAGCCGCCGCAGGGG + Intergenic
1061453563 9:130681786-130681808 GCGCTGGGGTTGCGCCCCGGAGG + Exonic
1061615175 9:131774607-131774629 GCCCTGGGGTGCCGCAGAGGAGG - Intergenic
1061762101 9:132858110-132858132 GTGCTGCGGTGCCACCGAGCAGG - Intronic
1062022557 9:134326353-134326375 GCGCTGCGGCGCCGGCGGGGGGG - Intronic
1062574631 9:137200483-137200505 GCGCGGCGGGGGCGCGGCGGGGG - Exonic
1185736622 X:2500831-2500853 CTGCTGCGGCGCTGCCGCGGGGG - Exonic
1186426091 X:9465202-9465224 GCGCTGCGGCGGCGGCGGGGCGG - Exonic
1189323182 X:40098179-40098201 CCGCTGCGGCGCCTCCGCGGCGG + Intronic
1190062260 X:47219058-47219080 GAGCCGCGGGGCCGGCGCGGCGG - Intronic
1193655072 X:84188295-84188317 ACGCCGCTGTGCCGCCGCCGTGG - Intergenic
1196816233 X:119667292-119667314 ACGCTGCGGTGCTGCCCCTGAGG - Intronic
1198767084 X:140091310-140091332 GAGCTGCGGGGCCGCAGCGGCGG + Intergenic
1201904747 Y:19077125-19077147 CCGCTGCGGTAGCGCCGCCGGGG - Intergenic