ID: 1148755769

View in Genome Browser
Species Human (GRCh38)
Location 17:49972246-49972268
Sequence CGCGCTGCGGTGCCGCCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755769_1148755783 25 Left 1148755769 17:49972246-49972268 CCCCGCGGCGGCACCGCAGCGCG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1148755783 17:49972294-49972316 CGCTGCGCGCTCTTGGAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1148755769_1148755775 -2 Left 1148755769 17:49972246-49972268 CCCCGCGGCGGCACCGCAGCGCG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148755769_1148755782 18 Left 1148755769 17:49972246-49972268 CCCCGCGGCGGCACCGCAGCGCG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1148755769_1148755784 26 Left 1148755769 17:49972246-49972268 CCCCGCGGCGGCACCGCAGCGCG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1148755784 17:49972295-49972317 GCTGCGCGCTCTTGGAACCCGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1148755769_1148755776 -1 Left 1148755769 17:49972246-49972268 CCCCGCGGCGGCACCGCAGCGCG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755769 Original CRISPR CGCGCTGCGGTGCCGCCGCG GGG (reversed) Intronic
900255032 1:1693434-1693456 CGGGGGGCGGGGCCGCCGCGCGG + Intronic
900263775 1:1746700-1746722 CGGGGGGCGGGGCCGCCGCGCGG + Intergenic
900402737 1:2479270-2479292 CGCGCTGCGGAGCCCCCAGGGGG + Intronic
900786783 1:4654705-4654727 CGCGCGGCGGCGGCGCCGCGCGG - Intergenic
901525950 1:9823658-9823680 CGGGCTGCTGTGCGGCGGCGGGG - Exonic
903389415 1:22953606-22953628 CGCGCAGCGGGGCTACCGCGTGG - Exonic
903603056 1:24556124-24556146 AGCGCGGCGGTGCCGGCGGGAGG + Exonic
905548386 1:38817752-38817774 CGCCCACAGGTGCCGCCGCGGGG + Intergenic
906197177 1:43936400-43936422 CGCGCCGCGCGGCCCCCGCGGGG - Exonic
906365532 1:45206438-45206460 CGCCCAGCGGTGGCGCCGAGGGG + Exonic
907038420 1:51236602-51236624 CGCCCCACGGTGCCGCCGAGGGG - Exonic
919403264 1:197146478-197146500 CCCGCTCCGGAGCCGCCTCGTGG - Exonic
920886877 1:209938132-209938154 CGCCCGGCTGTGCGGCCGCGAGG - Intergenic
1062843792 10:689725-689747 CGCGCTGAGGAGGCGCCGAGGGG - Intronic
1064583529 10:16817258-16817280 CTCGCTGCGTGGCCGCAGCGGGG - Exonic
1064769541 10:18710278-18710300 CGCGCGGTGGCGCCGCCGCCAGG - Intergenic
1070923816 10:80205284-80205306 CGCGGTGCACTGCCGCCGCCTGG + Intronic
1073297623 10:102450712-102450734 CGAGCTGCGCTGGGGCCGCGTGG - Exonic
1074065465 10:110008558-110008580 CGGCCTGCGGCGCCGCCGGGTGG + Intronic
1074865790 10:117543681-117543703 CGCGCTGCAGTTCCGCGACGTGG - Intronic
1076849998 10:133088062-133088084 CGCGCTGCGCTCCCCCCGCCGGG - Exonic
1078514371 11:12009409-12009431 CGGGCTGCGGCCCCTCCGCGGGG - Intronic
1083758394 11:64803186-64803208 CGAGCTGCGGAGCCGGCGCGGGG + Exonic
1083886561 11:65576138-65576160 CGCTCTCCGCTGCCGCCGCTGGG - Exonic
1083904884 11:65662967-65662989 CGCGCTGCCCCGCCGCCGCCCGG + Exonic
1084408907 11:68994713-68994735 CCCGCTGCGGTACCTCCTCGAGG - Intergenic
1090832309 11:130428137-130428159 CGCGCTGCCGGGCAACCGCGTGG + Exonic
1093464881 12:19439527-19439549 CGCGCTACGGAGCCCGCGCGGGG - Intronic
1107830968 13:44373691-44373713 CGCGCTGCGCTCCGGCCGCTCGG + Intronic
1113831229 13:113297345-113297367 GGCGCTGCGGTGGCGGGGCGCGG - Exonic
1115851842 14:37595411-37595433 CGCGCAGCGGTGAAGCGGCGGGG - Intronic
1121168831 14:91836334-91836356 CGCGCTGGGCCGGCGCCGCGCGG + Intronic
1124629396 15:31328038-31328060 CGCGCTCGGGTGGGGCCGCGGGG + Intronic
1127922575 15:63504841-63504863 TGCGCTGCGGGGCCGGCCCGTGG - Intronic
1130076510 15:80695030-80695052 CGCGCGGCGGCGCCGCCGCTGGG - Intronic
1130076512 15:80695031-80695053 CCAGCGGCGGCGCCGCCGCGCGG + Intronic
1135712599 16:24730069-24730091 CGGACTGCGGTCCCGCGGCGCGG - Intronic
1136561599 16:31042350-31042372 GGCGCTGCGGGGCCACCGGGAGG - Intronic
1142379233 16:89722112-89722134 CGCCCTGGGGTGCCCGCGCGTGG + Intronic
1143520051 17:7439790-7439812 CGGGCCGCGGTCCGGCCGCGCGG - Exonic
1143583919 17:7842120-7842142 CGCGCAGCGCCGCAGCCGCGCGG - Intronic
1146909928 17:36641894-36641916 CGCGATGCGGGGCGGACGCGCGG - Intergenic
1147761215 17:42798694-42798716 CCCTTCGCGGTGCCGCCGCGCGG + Exonic
1148755769 17:49972246-49972268 CGCGCTGCGGTGCCGCCGCGGGG - Intronic
1149263152 17:54900716-54900738 CGTTCTGCGCTGCCGCTGCGGGG - Exonic
1150643488 17:66964683-66964705 CGGGCTGCGCGGCCGCCGGGCGG - Intergenic
1157613940 18:48975973-48975995 CGCGCAGCGGAGGCGCCGGGCGG + Intergenic
1160968595 19:1757555-1757577 CGCGCGGCGGGGCCACGGCGTGG - Intronic
1163822127 19:19502070-19502092 CGGGCTGCGGTGGGGGCGCGAGG - Intronic
1165089301 19:33374175-33374197 CGCGCTCCCGGCCCGCCGCGAGG - Intronic
1165366643 19:35371482-35371504 CAAGCTGCGGTGCCGCCCGGTGG + Exonic
1167218592 19:48182500-48182522 CCCGCTGCGGGACCGCCTCGTGG + Exonic
1167258233 19:48443438-48443460 CGCGCAGCGGTCCGGCCGCCTGG + Exonic
1167646884 19:50710790-50710812 TGCCCTGCCGTGCCGCCACGTGG + Intronic
1167743933 19:51340190-51340212 TGCGCTGCGCCGCCGCCTCGCGG - Exonic
937361650 2:121233891-121233913 CACACTGCGGGGCCGCCACGAGG + Intronic
937917363 2:127105787-127105809 CCCGCTGCGCGGCCGCCGGGTGG - Intronic
938909902 2:135876338-135876360 CCGGCTCCGCTGCCGCCGCGAGG + Exonic
941666267 2:168246875-168246897 CGGGCTGCGGTCCCGGCACGCGG + Intronic
945188872 2:207166374-207166396 CGCGCTGCCCGGCCGCCGGGCGG - Intronic
1172702899 20:36863602-36863624 CGCGCTCCGGGGGCGCGGCGAGG - Exonic
1172951211 20:38724469-38724491 TGCACTGCGGAGCTGCCGCGGGG - Exonic
1174475971 20:50795556-50795578 CGCGCTGCGCTGCTGCAGCTCGG + Intronic
1177754396 21:25328078-25328100 CGGGCTGCAGTGCAGCGGCGCGG - Intergenic
1180744410 22:18077973-18077995 CGCGCCGCCGGGACGCCGCGCGG + Exonic
1181934544 22:26429382-26429404 GGCGCCGCGGAGCCGCCGCCTGG - Exonic
1181966346 22:26658732-26658754 CCCACTGCAGTGCCGCCGCGGGG + Intergenic
953399530 3:42600803-42600825 CGCGCTGCGTGGGAGCCGCGAGG + Intronic
954110230 3:48429410-48429432 CGCGCGGCGCTGCCACCGCCGGG + Exonic
954540591 3:51391079-51391101 CGCGCTCTGGCGCCACCGCGCGG - Intergenic
954693768 3:52409883-52409905 GGCGCTGAGGGGCCGCCCCGCGG - Exonic
956813619 3:72888347-72888369 GGCGCTGCGGGGCGGACGCGGGG - Exonic
957078652 3:75619692-75619714 CGGGATGCGGGGCTGCCGCGGGG + Intergenic
963133249 3:141877037-141877059 CGCACTGCGCCGCCGCCGCCCGG - Intronic
972321699 4:37977833-37977855 CGCGCCGCGGAGCTGCCGCTCGG + Intronic
981093458 4:140756280-140756302 CGCGGGGCGGCGACGCCGCGGGG - Intergenic
982257586 4:153466078-153466100 CGCGCTGCGGGGCGGGCCCGCGG + Intergenic
984823624 4:183905819-183905841 GGAGCAGCGCTGCCGCCGCGCGG + Exonic
986321222 5:6633800-6633822 CGCGCTGCGGAGACGCGGGGCGG - Exonic
997583991 5:135034107-135034129 CGCGCTGCGCTCCTGCCGCTCGG + Exonic
1003089851 6:3092447-3092469 CGCGCTGCGGTTCCGAGGTGCGG - Intronic
1003089857 6:3092478-3092500 CGCGCTGCGGTTCCGAGGTGCGG - Intronic
1003089863 6:3092509-3092531 CGCGCTGCGGTTCCGAGGTGCGG - Intronic
1003089869 6:3092540-3092562 CGCGCTGCGGTTCCGAGGTGCGG - Intronic
1003089875 6:3092571-3092593 CGCGCTGCGGTTCCGAGGTGCGG - Intronic
1005622316 6:27631332-27631354 CGCGCTGCCGCTCCGGCGCGAGG + Intergenic
1006643114 6:35498428-35498450 CGTGCTGCAGTTCGGCCGCGTGG - Exonic
1008816901 6:55579192-55579214 CGCACTGCGGCGGCGCCGAGAGG + Intronic
1013030228 6:106325586-106325608 CGCGCTCCGGTGGGGCGGCGGGG + Exonic
1016328222 6:142927000-142927022 CGCGCGGCGGCGCGGCGGCGCGG + Intronic
1016400849 6:143678226-143678248 CGCGATGCGCTCCCGCCGCGCGG + Intronic
1020727289 7:11831885-11831907 GGCGCTGCGGGGCCGCGCCGGGG - Exonic
1028417576 7:90596340-90596362 CGCGCCGCGCCGCCGCCGCCCGG - Intronic
1029286572 7:99469686-99469708 CGCGCTGCCGTTGCGCCACGAGG - Intergenic
1033461541 7:141551329-141551351 CGCCCTCGGGTTCCGCCGCGGGG - Exonic
1034977740 7:155457988-155458010 CGGGCTCCGGCGCCGCCGCCTGG - Intergenic
1042962625 8:74320613-74320635 AGCGCTGCGCTGCCACCGGGAGG - Intronic
1045269416 8:100649448-100649470 CGCGCTGGGGGGCCGCTACGTGG - Exonic
1047961660 8:130016077-130016099 CGCGCAGCGGGGCCGCCGCCCGG - Intronic
1048981711 8:139705984-139706006 CCGGCTGCGCGGCCGCCGCGTGG - Intergenic
1054905840 9:70413281-70413303 CGCGCTGCGGTGCCGGAGCATGG - Exonic
1056992631 9:91424746-91424768 CGCGCTCGGGTGCCCCCGCTGGG + Intergenic
1057693545 9:97307899-97307921 TGCCCTGGGGTGCCGCCTCGAGG + Intronic
1061075823 9:128340817-128340839 CGCGCGGCGGAGCCGACGCCGGG + Exonic
1061281032 9:129597685-129597707 CGCCCTGCGGCGCGGCCTCGTGG - Intergenic
1062022558 9:134326354-134326376 GGCGCTGCGGCGCCGGCGGGGGG - Intronic
1062499570 9:136846496-136846518 CTCGCGCCTGTGCCGCCGCGAGG + Exonic
1192546510 X:72018765-72018787 GGCGCTGCAGTGCGGCTGCGGGG + Intergenic
1192903316 X:75522970-75522992 GGGGCTGCGGTGCTGCCGCCGGG - Exonic
1198705832 X:139447120-139447142 CGCGCTGCGGAGGCGCGGGGTGG - Intergenic
1201904749 Y:19077126-19077148 CCCGCTGCGGTAGCGCCGCCGGG - Intergenic