ID: 1148755770

View in Genome Browser
Species Human (GRCh38)
Location 17:49972247-49972269
Sequence TCGCGCTGCGGTGCCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755770_1148755784 25 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755784 17:49972295-49972317 GCTGCGCGCTCTTGGAACCCGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1148755770_1148755775 -3 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148755770_1148755782 17 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1148755770_1148755776 -2 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1148755770_1148755783 24 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755783 17:49972294-49972316 CGCTGCGCGCTCTTGGAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755770 Original CRISPR TCGCGCTGCGGTGCCGCCGC GGG (reversed) Intronic