ID: 1148755770

View in Genome Browser
Species Human (GRCh38)
Location 17:49972247-49972269
Sequence TCGCGCTGCGGTGCCGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755770_1148755775 -3 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148755770_1148755784 25 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755784 17:49972295-49972317 GCTGCGCGCTCTTGGAACCCGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1148755770_1148755782 17 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1148755770_1148755783 24 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755783 17:49972294-49972316 CGCTGCGCGCTCTTGGAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1148755770_1148755776 -2 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755770 Original CRISPR TCGCGCTGCGGTGCCGCCGC GGG (reversed) Intronic
900402736 1:2479269-2479291 TCGCGCTGCGGAGCCCCCAGGGG + Intronic
903435334 1:23344667-23344689 TCGCGCCGCGTGGCCGCCTCCGG + Intergenic
905548385 1:38817751-38817773 TCGCCCACAGGTGCCGCCGCGGG + Intergenic
913221876 1:116666926-116666948 TCGCGCTGGGGTACCGCTTCAGG - Exonic
916128406 1:161591195-161591217 TCGTGCTGAGGTGCCACAGCTGG + Intronic
916138323 1:161673026-161673048 TCGTGCTGAGGTGCCACAGCTGG + Exonic
1064583530 10:16817259-16817281 TCTCGCTGCGTGGCCGCAGCGGG - Exonic
1076849999 10:133088063-133088085 ACGCGCTGCGCTCCCCCCGCCGG - Exonic
1082756218 11:57079088-57079110 TCACGCTGTGGTGCCTCAGCTGG + Intergenic
1083758393 11:64803185-64803207 GCGAGCTGCGGAGCCGGCGCGGG + Exonic
1083886562 11:65576139-65576161 GCGCTCTCCGCTGCCGCCGCTGG - Exonic
1083997116 11:66278148-66278170 TCGCGCGGCGGCCCCGCCCCCGG + Intergenic
1085289100 11:75384606-75384628 CCGCGCTGTGGTTCCGCAGCAGG - Intergenic
1095440958 12:42238307-42238329 CCGCGCTCGGGAGCCGCCGCCGG + Intronic
1096137144 12:49211976-49211998 TCTCGCTGCGATGCCCCAGCTGG - Intronic
1100186452 12:92145265-92145287 TCGCGCTTGGGCCCCGCCGCGGG - Intronic
1102157480 12:110742728-110742750 TCCCGCAGCGGCGCCGCCGCCGG + Exonic
1104336262 12:127898802-127898824 GCGCGCTGGGGTGCGGCCTCGGG + Intergenic
1105211422 13:18259293-18259315 TCGAGCTGCTGTCCCGTCGCAGG - Intergenic
1112693052 13:101917158-101917180 CCGCGGGCCGGTGCCGCCGCCGG + Intronic
1113867669 13:113538349-113538371 TCAAGCTGCGGTGCAGCCGAGGG - Intronic
1114195078 14:20469737-20469759 TCGAGCTGGGGTGGCGCCACCGG + Intronic
1119247312 14:73122775-73122797 CAGCGCTGGGGTGGCGCCGCAGG + Exonic
1121042123 14:90758279-90758301 TCTCGCGCAGGTGCCGCCGCAGG - Intronic
1122703708 14:103607250-103607272 TGGTGCTGTGGTGCAGCCGCAGG + Intronic
1126852437 15:52805563-52805585 TTGGGCTGCGGTGCCTCCGGGGG + Intergenic
1130076511 15:80695031-80695053 CCGCGCGGCGGCGCCGCCGCTGG - Intronic
1130649723 15:85755694-85755716 TCCCTCTGCGGTCCCGACGCTGG + Intergenic
1132326324 15:100973414-100973436 TCCCGCTGCGGTGCCCACGGGGG - Intronic
1142631711 17:1229842-1229864 TCGGGCCGCGGAGCCGCCGGGGG + Intergenic
1143390534 17:6556734-6556756 GCGCGCTGCGGTGGCCGCGCGGG - Intergenic
1146720439 17:35119840-35119862 TCGCGCCGCGCTGCCGCTTCCGG + Intronic
1148755770 17:49972247-49972269 TCGCGCTGCGGTGCCGCCGCGGG - Intronic
1162554907 19:11380883-11380905 TCGCGCTGCTCTCCCACCGCCGG - Exonic
948487189 2:238288535-238288557 TCGGGCAGCGGAGGCGCCGCCGG - Exonic
1171473543 20:25390534-25390556 CCGCGCTGCGCAGCCGACGCGGG - Exonic
1175517228 20:59577416-59577438 TCGCGTGGCGGCGCCGCCCCCGG + Intergenic
1181966344 22:26658731-26658753 CCCCACTGCAGTGCCGCCGCGGG + Intergenic
1182144766 22:27990651-27990673 ACGGGCTGCGGCGCCCCCGCGGG - Intronic
954110229 3:48429409-48429431 CCGCGCGGCGCTGCCACCGCCGG + Exonic
956813620 3:72888348-72888370 TGGCGCTGCGGGGCGGACGCGGG - Exonic
965590440 3:170356992-170357014 TCCCCCTGCGGGGCCGCAGCTGG - Intergenic
968199497 3:196740082-196740104 GCGGGCTGCGGAGCCGCCCCGGG - Exonic
981093459 4:140756281-140756303 TCGCGGGGCGGCGACGCCGCGGG - Intergenic
985629046 5:1005364-1005386 CCGAGCTGCGCTGCAGCCGCTGG + Intergenic
1003314948 6:5003779-5003801 TCGCGGGGCGGGGCCGCCGGCGG - Intronic
1004861031 6:19804888-19804910 CCGCGCTGCGCTGCCTCCCCCGG - Intergenic
1011193999 6:84763947-84763969 AGGCGCTGCGCTCCCGCCGCCGG - Exonic
1019577925 7:1746465-1746487 CCACGCTGTGGTGCCGCTGCAGG - Exonic
1019735242 7:2647138-2647160 TCCCACTGCGATGCCGGCGCTGG - Exonic
1026931538 7:74225504-74225526 ACGCGCTGAGGAGCCACCGCAGG + Intronic
1031043566 7:116862975-116862997 TCGGGCCGCGGGGCCTCCGCCGG + Intronic
1045305179 8:100951811-100951833 TCGCCCCGCGGTGGCGGCGCCGG - Intronic
1045403750 8:101844554-101844576 TCTCGCTGCGTTGCCACAGCTGG + Intronic
1045571314 8:103371557-103371579 CCGCGCTCCGAGGCCGCCGCAGG - Exonic
1049828345 8:144684914-144684936 GTGCGCTGCGGTGCAGCCTCGGG - Intergenic
1052970091 9:34372113-34372135 TGGCGCTGCGGCGCGGCCGGCGG + Exonic
1056992630 9:91424745-91424767 CCGCGCTCGGGTGCCCCCGCTGG + Intergenic
1060484987 9:124041121-124041143 TGGGGCTGCAGAGCCGCCGCAGG + Intergenic
1060656644 9:125376651-125376673 TGGCGCTGAGGATCCGCCGCAGG + Intergenic
1061075822 9:128340816-128340838 CCGCGCGGCGGAGCCGACGCCGG + Exonic
1061283672 9:129610718-129610740 GCGCGCCGCGGTGCTGCAGCCGG + Intronic
1062327236 9:136018130-136018152 TCCTGGTGCGGTGCGGCCGCAGG - Intronic
1062341409 9:136095304-136095326 CCCCGCCGCGGTGCGGCCGCCGG - Intergenic
1062676928 9:137752182-137752204 TCGCGGGGCGGGGGCGCCGCCGG - Intronic
1203792464 EBV:159230-159252 GCTCGCTGCTGTGACGCCGCAGG - Intergenic
1192903317 X:75522971-75522993 GGGGGCTGCGGTGCTGCCGCCGG - Exonic
1200292461 X:154886252-154886274 TCGGGCTGGGGAGCCGGCGCGGG + Intronic
1200339305 X:155381992-155382014 TCGGGCTGGGGAGCCGGCGCGGG + Intergenic
1200347165 X:155458701-155458723 TCGGGCTGGGGAGCCGGCGCGGG - Intergenic
1201904751 Y:19077127-19077149 TCCCGCTGCGGTAGCGCCGCCGG - Intergenic