ID: 1148755771

View in Genome Browser
Species Human (GRCh38)
Location 17:49972248-49972270
Sequence ATCGCGCTGCGGTGCCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 30}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755771_1148755784 24 Left 1148755771 17:49972248-49972270 CCGCGGCGGCACCGCAGCGCGAT 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1148755784 17:49972295-49972317 GCTGCGCGCTCTTGGAACCCGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1148755771_1148755783 23 Left 1148755771 17:49972248-49972270 CCGCGGCGGCACCGCAGCGCGAT 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1148755783 17:49972294-49972316 CGCTGCGCGCTCTTGGAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1148755771_1148755775 -4 Left 1148755771 17:49972248-49972270 CCGCGGCGGCACCGCAGCGCGAT 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148755771_1148755782 16 Left 1148755771 17:49972248-49972270 CCGCGGCGGCACCGCAGCGCGAT 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1148755771_1148755776 -3 Left 1148755771 17:49972248-49972270 CCGCGGCGGCACCGCAGCGCGAT 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755771 Original CRISPR ATCGCGCTGCGGTGCCGCCG CGG (reversed) Intronic
900402735 1:2479268-2479290 GTCGCGCTGCGGAGCCCCCAGGG + Intronic
900540261 1:3199211-3199233 ATGGCCATGGGGTGCCGCCGAGG + Intronic
900663864 1:3800473-3800495 GTCGCTCTGTGGTGCCGCCTGGG + Intergenic
905137107 1:35808294-35808316 TTGGCGCTGGGGTGGCGCCGCGG - Exonic
906365530 1:45206436-45206458 AGCGCCCAGCGGTGGCGCCGAGG + Exonic
907038423 1:51236604-51236626 ACCGCCCCACGGTGCCGCCGAGG - Exonic
921909167 1:220528603-220528625 TTCCCGCGGCGGCGCCGCCGGGG - Exonic
1067145422 10:43690240-43690262 AGGGCGCTGCGGGGCGGCCGTGG + Intergenic
1075753369 10:124791786-124791808 GTGGCGCTGCGGTGGCGGCGCGG - Exonic
1083933494 11:65858376-65858398 TGCGCGCTGCGGTGCCGCCCAGG - Exonic
1084978155 11:72814463-72814485 AGCGCGCTGCGGGGGCACCGGGG - Exonic
1096102635 12:48978874-48978896 ATCGCCCTTCGGTGTCGCGGAGG - Intronic
1102329048 12:112013628-112013650 GTCGCGCGCAGGTGCCGCCGGGG + Intronic
1108063492 13:46554249-46554271 ATCGCTCGGCGATGTCGCCGAGG - Intronic
1113867670 13:113538350-113538372 ATCAAGCTGCGGTGCAGCCGAGG - Intronic
1126087329 15:45022715-45022737 AGCGCGCTGCAGGGCCGGCGCGG + Intergenic
1126852436 15:52805562-52805584 GTTGGGCTGCGGTGCCTCCGGGG + Intergenic
1132326325 15:100973415-100973437 GTCCCGCTGCGGTGCCCACGGGG - Intronic
1138016751 16:53435044-53435066 ATCGCGCTGGGGTCCCGTTGAGG + Intronic
1142631710 17:1229841-1229863 CTCGGGCCGCGGAGCCGCCGGGG + Intergenic
1148755771 17:49972248-49972270 ATCGCGCTGCGGTGCCGCCGCGG - Intronic
1156099598 18:33578278-33578300 CTCGCGCTGCGCCACCGCCGCGG - Intergenic
932595084 2:73088545-73088567 ATGGAGCTGCGGTGCCGCACAGG + Exonic
948370565 2:237486959-237486981 ATCGCGCCGCGGTCCTGCCTTGG - Intronic
1179797598 21:43794445-43794467 AACACCCTGCGGTGCCACCGAGG - Intronic
1181966342 22:26658730-26658752 ACCCCACTGCAGTGCCGCCGCGG + Intergenic
960269436 3:115658453-115658475 ATCACACTGCAGAGCCGCCGAGG - Intronic
963827434 3:149970647-149970669 CCCGCGCTGCGGTGCCCCCGCGG + Intronic
985696184 5:1341770-1341792 ATCACGCTGGGGTCCTGCCGTGG - Exonic
1011837069 6:91445467-91445489 ATCACGGTGCGGTGCAGCCTGGG + Intergenic
1027190721 7:75994280-75994302 AGCGCGATGGGGTCCCGCCGGGG + Intronic
1048881848 8:138877904-138877926 AGCGCGGTGGGCTGCCGCCGCGG + Exonic
1062442675 9:136578179-136578201 ATCGCGCTGCGCTGCTGGCCTGG + Intergenic
1198767082 X:140091307-140091329 ACCGAGCTGCGGGGCCGCAGCGG + Intergenic