ID: 1148755772

View in Genome Browser
Species Human (GRCh38)
Location 17:49972253-49972275
Sequence GCGGCACCGCAGCGCGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755763_1148755772 19 Left 1148755763 17:49972211-49972233 CCTGGAGAGCTAGGCGGGCCAGA 0: 1
1: 0
2: 4
3: 10
4: 143
Right 1148755772 17:49972253-49972275 GCGGCACCGCAGCGCGATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1148755764_1148755772 1 Left 1148755764 17:49972229-49972251 CCAGAGCTGACCAGATCCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1148755772 17:49972253-49972275 GCGGCACCGCAGCGCGATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1148755767_1148755772 -9 Left 1148755767 17:49972239-49972261 CCAGATCCCCCGCGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1148755772 17:49972253-49972275 GCGGCACCGCAGCGCGATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1148755760_1148755772 27 Left 1148755760 17:49972203-49972225 CCGAGATTCCTGGAGAGCTAGGC 0: 1
1: 0
2: 2
3: 16
4: 148
Right 1148755772 17:49972253-49972275 GCGGCACCGCAGCGCGATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755772 Original CRISPR GCGGCACCGCAGCGCGATCC AGG Intronic
906365583 1:45206620-45206642 GCGGGCCCGCGGCGCGCTCCAGG + Intronic
908381154 1:63598018-63598040 GCAGCACAGTAGCGCGATCGTGG + Intronic
911133801 1:94418327-94418349 GCGGCGCGGCGGCGCGAGCCAGG + Intergenic
920348374 1:205321460-205321482 GCGGCACCGCTACGAGTTCCTGG - Exonic
1066650614 10:37651586-37651608 GGGGCAGCGCAGCGCCCTCCAGG + Intergenic
1067474708 10:46557586-46557608 GCAGCACCACAGCGCCTTCCCGG + Intergenic
1079128592 11:17735158-17735180 GCGGAACCCCAGCTCGAGCCCGG + Exonic
1081969261 11:47186628-47186650 GCGGCACCGGGGCGCAACCCTGG - Intergenic
1084146167 11:67266480-67266502 GCGGGAGCGGAGCGCGAGCCGGG + Exonic
1098521716 12:71440521-71440543 GCGGCGCAGCAGCGCTTTCCCGG - Intronic
1103701020 12:122848813-122848835 GCGGTACCGCAGCAACATCCGGG + Exonic
1109683563 13:65784274-65784296 GGGGCACCTCAGCTCCATCCCGG + Intergenic
1121308659 14:92923259-92923281 GTGCCACCGCAGCCCGACCCCGG + Exonic
1128199341 15:65791810-65791832 TCAGCACCGCCGCGCCATCCCGG + Intronic
1132506133 16:310017-310039 GCAGCACCGCAGGGAGATGCAGG - Exonic
1132775319 16:1590463-1590485 GCGGCACAGCAGCGACACCCAGG - Intronic
1132837996 16:1964391-1964413 GCGGCGCCGGAGAGCGGTCCTGG - Intronic
1134492142 16:14703322-14703344 GCGGCACCGCAGCAGCCTCCAGG - Intergenic
1134497523 16:14742444-14742466 GCGGCACCGCAGCAGCCTCCAGG - Intronic
1137300261 16:47143007-47143029 GCGGCACCACTGCGGGCTCCGGG - Intronic
1139467775 16:67163417-67163439 GCGGCGGCGCAACGCGACCCAGG - Exonic
1141989757 16:87603006-87603028 GCGGCCCCGGAGCGCGGTCTCGG - Exonic
1142795517 17:2303905-2303927 GCGGGACCGGAGCGAGAGCCTGG + Exonic
1145041276 17:19579873-19579895 GCGGGACCGCAGCGCGGTGTGGG - Intergenic
1148755772 17:49972253-49972275 GCGGCACCGCAGCGCGATCCAGG + Intronic
1155570335 18:27185332-27185354 GCGGCGCCGCAGCCCCAGCCGGG - Intergenic
1161572566 19:5038512-5038534 GCGGCACTGCAGCCGGAACCCGG - Intronic
1163419449 19:17205948-17205970 CCGGCACTGCAGGGCGAGCCAGG + Exonic
1163557392 19:18000541-18000563 GGGGCACAGTAGCGTGATCCTGG - Intergenic
925928187 2:8685409-8685431 GCGGGTCCGCAGGGCGATCCGGG - Intergenic
932180692 2:69643660-69643682 GCGGCGCTGCAGCGAGAGCCGGG + Exonic
932595083 2:73088540-73088562 GCGGCACCGCAGCTCCATCTCGG - Exonic
937046282 2:118853760-118853782 CCGGCCCCGGAGCCCGATCCAGG + Intergenic
938386716 2:130872045-130872067 GCAGCACCGCAGCGCGGTTCAGG + Intronic
945320189 2:208412281-208412303 GCAGCACAGCTGTGCGATCCTGG - Intronic
1181006610 22:20016605-20016627 GCGGCCCCGCAGCGCGGCCTCGG + Exonic
1183437748 22:37805123-37805145 GCGGCGGCGCAGCGCCATTCCGG + Exonic
955911682 3:63864256-63864278 GCGGCCCCGCCGCCCCATCCAGG + Intergenic
963827431 3:149970642-149970664 GGGGCACCGCAGCGCGGGGCTGG - Intronic
972607730 4:40629776-40629798 GTGGAACCGCCGCGCGCTCCCGG - Intronic
982573300 4:157076496-157076518 GCGCCACCGCAGCGGGGACCCGG - Intronic
1006166342 6:32067916-32067938 GCGGCTCCTCAGCGGGCTCCGGG + Intronic
1007181860 6:39934432-39934454 GCGGAACCGCAGCCCGCTTCGGG + Intronic
1008597985 6:53061934-53061956 GCGGCTCGGCCGCGCGAGCCAGG - Intronic
1014814517 6:125921026-125921048 ACGGCCCCACAGCGCGCTCCTGG + Exonic
1019925696 7:4190815-4190837 GGGGCACCACAGCTCCATCCTGG - Intronic
1026850351 7:73719697-73719719 GCGGCTGCGCAGCGCCAGCCCGG + Intergenic
1027138234 7:75639292-75639314 GCGGAGCCGCAGCGCGCGCCGGG + Intronic
1035559221 8:592788-592810 CAGGCACCGCCGCGCGCTCCTGG - Intergenic
1036032700 8:4991649-4991671 GGGGCTCGGCAGCGCGCTCCAGG - Intronic
1042737510 8:72005305-72005327 GCAGCACCGAAGCGCGGGCCAGG + Intronic
1061065639 9:128275968-128275990 GGGCCACATCAGCGCGATCCCGG + Exonic