ID: 1148755772

View in Genome Browser
Species Human (GRCh38)
Location 17:49972253-49972275
Sequence GCGGCACCGCAGCGCGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755764_1148755772 1 Left 1148755764 17:49972229-49972251 CCAGAGCTGACCAGATCCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1148755772 17:49972253-49972275 GCGGCACCGCAGCGCGATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1148755760_1148755772 27 Left 1148755760 17:49972203-49972225 CCGAGATTCCTGGAGAGCTAGGC 0: 1
1: 0
2: 2
3: 16
4: 148
Right 1148755772 17:49972253-49972275 GCGGCACCGCAGCGCGATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1148755767_1148755772 -9 Left 1148755767 17:49972239-49972261 CCAGATCCCCCGCGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1148755772 17:49972253-49972275 GCGGCACCGCAGCGCGATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1148755763_1148755772 19 Left 1148755763 17:49972211-49972233 CCTGGAGAGCTAGGCGGGCCAGA 0: 1
1: 0
2: 4
3: 10
4: 143
Right 1148755772 17:49972253-49972275 GCGGCACCGCAGCGCGATCCAGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755772 Original CRISPR GCGGCACCGCAGCGCGATCC AGG Intronic