ID: 1148755773

View in Genome Browser
Species Human (GRCh38)
Location 17:49972258-49972280
Sequence ACCGCAGCGCGATCCAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755768_1148755773 -10 Left 1148755768 17:49972245-49972267 CCCCCGCGGCGGCACCGCAGCGC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1148755767_1148755773 -4 Left 1148755767 17:49972239-49972261 CCAGATCCCCCGCGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1148755763_1148755773 24 Left 1148755763 17:49972211-49972233 CCTGGAGAGCTAGGCGGGCCAGA 0: 1
1: 0
2: 4
3: 10
4: 143
Right 1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1148755764_1148755773 6 Left 1148755764 17:49972229-49972251 CCAGAGCTGACCAGATCCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755773 Original CRISPR ACCGCAGCGCGATCCAGGAG TGG Intronic
901381816 1:8879156-8879178 ATCGCGGCGCGAGGCAGGAGGGG - Intronic
915996929 1:160572955-160572977 GCCCCAGCCCAATCCAGGAGGGG - Intronic
1062895093 10:1097311-1097333 ACCGCAGCAGGATCCAGGACTGG + Intronic
1073578417 10:104642935-104642957 CCCGCAGCGCGTGCCCGGAGGGG + Intronic
1074249087 10:111725703-111725725 ACCACAGCACGTTCCTGGAGTGG + Intergenic
1077545889 11:3169637-3169659 ACCCCTGTGGGATCCAGGAGCGG - Intergenic
1081320829 11:41689743-41689765 TCTGCAGCACGATCCAGAAGAGG + Intergenic
1085272828 11:75280465-75280487 AGCACAGCCCGACCCAGGAGGGG + Intronic
1090977942 11:131691964-131691986 CCCGCAGTCCCATCCAGGAGGGG - Intronic
1093466643 12:19456357-19456379 ACAGCAGCGCGACCCAGAGGTGG + Intronic
1102947788 12:117005172-117005194 CCAGCAGCAAGATCCAGGAGTGG + Intronic
1103825589 12:123735572-123735594 AGCGGAGGGAGATCCAGGAGGGG + Exonic
1111582351 13:90239099-90239121 ACCATAGCACTATCCAGGAGAGG + Intergenic
1115796750 14:36945421-36945443 ACAGCAGCGCTATTCATGAGAGG + Intronic
1122150997 14:99726226-99726248 ACTGCTGCCCGATGCAGGAGCGG - Exonic
1126671720 15:51121367-51121389 ACCTCAGCTTGAGCCAGGAGAGG - Intergenic
1127225195 15:56919733-56919755 ACCGCGGCGCGAGCAAGGGGCGG - Intronic
1128199344 15:65791815-65791837 ACCGCCGCGCCATCCCGGGGCGG + Intronic
1129116299 15:73367309-73367331 CCCCCAGCGCGGTGCAGGAGGGG + Intronic
1141549388 16:84795209-84795231 GCCGCAGCGAGATGAAGGAGAGG - Intergenic
1146797937 17:35795700-35795722 ACCGCCTCGCGTTCCAGCAGCGG - Intronic
1147159490 17:38562050-38562072 GCCCCAGCGCCATCCTGGAGCGG - Exonic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1152554923 17:81048406-81048428 ACCCCAGCACGGCCCAGGAGTGG + Intronic
1160373472 18:78392806-78392828 TACGCAGCGCCATCCAAGAGGGG - Intergenic
1160583495 18:79900606-79900628 GCCGCAGCCCGAAGCAGGAGGGG + Intergenic
1165155381 19:33783943-33783965 ACCACAGCTCCACCCAGGAGTGG + Intergenic
1165937421 19:39397807-39397829 ACCGCAGCGGGAGCCAGCAGGGG + Exonic
938386717 2:130872050-130872072 ACCGCAGCGCGGTTCAGGTCAGG + Intronic
942438095 2:176002600-176002622 ACCGCCGCGCGAGCGAAGAGTGG + Intronic
946038758 2:216765972-216765994 ACCCCAGAGCCAGCCAGGAGTGG - Intergenic
948726931 2:239939857-239939879 ACTGCAGCCGGTTCCAGGAGGGG - Intronic
1168837224 20:885310-885332 CCCGCAGCGCGCTCGAGAAGCGG - Exonic
1171293300 20:23994804-23994826 AACGCAGCGTTCTCCAGGAGGGG - Intergenic
1172666783 20:36605821-36605843 ACCGCAGCGCGCCGCAGGACCGG + Exonic
1178849354 21:36200344-36200366 ACCGCCGCGTGTGCCAGGAGAGG - Exonic
1179511896 21:41879011-41879033 CGCGCAGGGCGATCCCGGAGCGG + Exonic
1180824361 22:18852519-18852541 AACGCAGCGTTCTCCAGGAGGGG - Intronic
1181124787 22:20695673-20695695 AACGCAGCGTTCTCCAGGAGGGG - Intergenic
1181188373 22:21122029-21122051 AACGCAGCGTTCTCCAGGAGGGG + Intergenic
1181210825 22:21288464-21288486 AACGCAGCGTTCTCCAGGAGGGG - Intergenic
1181398684 22:22638424-22638446 AACGCAGCGTTCTCCAGGAGGGG + Intergenic
1181501416 22:23317780-23317802 AACGCAGCGTTCTCCAGGAGGGG + Exonic
1181650737 22:24257635-24257657 AACGCAGCGTTCTCCAGGAGGGG - Intergenic
1181706645 22:24653104-24653126 AACGCAGCGTTCTCCAGGAGGGG + Intergenic
1185070344 22:48652564-48652586 CACCCAGCGCCATCCAGGAGGGG + Intronic
968450918 4:675554-675576 ACCCCAGAGCAAGCCAGGAGAGG - Intronic
969640341 4:8394614-8394636 ACCGCAGCGCCAGACAGGTGAGG - Exonic
982750835 4:159159199-159159221 ACAGCTGCGTGATCCAGGAAAGG - Intronic
987129916 5:14850667-14850689 ACAGCAGCCAGCTCCAGGAGAGG - Intronic
1005940300 6:30555665-30555687 GCCGCAGCGGGAGCCGGGAGCGG - Exonic
1024473573 7:49788151-49788173 ACCACAGCCCGAGCCAGGAGTGG - Intronic
1032279042 7:130486438-130486460 CTCGCAGCCCGCTCCAGGAGTGG + Intronic
1037547613 8:19939676-19939698 CCCGGAGTGGGATCCAGGAGGGG + Intronic
1044860548 8:96519108-96519130 ACCGCAGAGGGATGTAGGAGAGG - Intronic
1049688548 8:143949013-143949035 GCCGCAGAGAGAGCCAGGAGGGG + Intronic
1052959948 9:34286858-34286880 ACCTCAGCCCGATTCAGGGGTGG + Intronic
1200883033 Y:8240671-8240693 ACCGCTGAGCGATCAATGAGGGG + Intergenic