ID: 1148755774 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:49972259-49972281 |
Sequence | GCCACTCCTGGATCGCGCTG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 80 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 71} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1148755774_1148755784 | 13 | Left | 1148755774 | 17:49972259-49972281 | CCGCAGCGCGATCCAGGAGTGGC | 0: 1 1: 0 2: 0 3: 8 4: 71 |
||
Right | 1148755784 | 17:49972295-49972317 | GCTGCGCGCTCTTGGAACCCGGG | 0: 1 1: 0 2: 0 3: 5 4: 73 |
||||
1148755774_1148755783 | 12 | Left | 1148755774 | 17:49972259-49972281 | CCGCAGCGCGATCCAGGAGTGGC | 0: 1 1: 0 2: 0 3: 8 4: 71 |
||
Right | 1148755783 | 17:49972294-49972316 | CGCTGCGCGCTCTTGGAACCCGG | 0: 1 1: 0 2: 0 3: 2 4: 44 |
||||
1148755774_1148755782 | 5 | Left | 1148755774 | 17:49972259-49972281 | CCGCAGCGCGATCCAGGAGTGGC | 0: 1 1: 0 2: 0 3: 8 4: 71 |
||
Right | 1148755782 | 17:49972287-49972309 | CGGGCTACGCTGCGCGCTCTTGG | 0: 1 1: 0 2: 0 3: 2 4: 38 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1148755774 | Original CRISPR | GCCACTCCTGGATCGCGCTG CGG (reversed) | Intronic | ||