ID: 1148755774

View in Genome Browser
Species Human (GRCh38)
Location 17:49972259-49972281
Sequence GCCACTCCTGGATCGCGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755774_1148755782 5 Left 1148755774 17:49972259-49972281 CCGCAGCGCGATCCAGGAGTGGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1148755774_1148755783 12 Left 1148755774 17:49972259-49972281 CCGCAGCGCGATCCAGGAGTGGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1148755783 17:49972294-49972316 CGCTGCGCGCTCTTGGAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1148755774_1148755784 13 Left 1148755774 17:49972259-49972281 CCGCAGCGCGATCCAGGAGTGGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1148755784 17:49972295-49972317 GCTGCGCGCTCTTGGAACCCGGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755774 Original CRISPR GCCACTCCTGGATCGCGCTG CGG (reversed) Intronic