ID: 1148755775

View in Genome Browser
Species Human (GRCh38)
Location 17:49972267-49972289
Sequence CGATCCAGGAGTGGCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 77}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755770_1148755775 -3 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148755771_1148755775 -4 Left 1148755771 17:49972248-49972270 CCGCGGCGGCACCGCAGCGCGAT 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148755768_1148755775 -1 Left 1148755768 17:49972245-49972267 CCCCCGCGGCGGCACCGCAGCGC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148755767_1148755775 5 Left 1148755767 17:49972239-49972261 CCAGATCCCCCGCGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148755764_1148755775 15 Left 1148755764 17:49972229-49972251 CCAGAGCTGACCAGATCCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77
1148755769_1148755775 -2 Left 1148755769 17:49972246-49972268 CCCCGCGGCGGCACCGCAGCGCG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755775 Original CRISPR CGATCCAGGAGTGGCCCCGC CGG Intronic
901318857 1:8327054-8327076 TGATCCAGCTGAGGCCCCGCAGG - Intronic
903155596 1:21440391-21440413 CGACCCAGGTGTGCGCCCGCCGG - Intronic
903925167 1:26826745-26826767 CGGTCCCGGAGTGGCCCGGCCGG + Exonic
913610593 1:120506222-120506244 GGATCCAGGAGTGGGGCCACTGG - Intergenic
914580597 1:149016017-149016039 GGATCCAGGAGTGGGGCCACTGG + Intronic
920298142 1:204972180-204972202 GGATGCAGGAGTCGCCCTGCAGG - Intronic
1069712978 10:70501533-70501555 CGTTCCAGCAGTGGCACCTCGGG + Intronic
1070888273 10:79923358-79923380 TGACCCAGGTGTGGCCCCACTGG - Intergenic
1070954352 10:80454509-80454531 CTGCCCAGGAGCGGCCCCGCGGG + Intronic
1075863513 10:125697786-125697808 CCATCGAGGAATGGCCCCGGAGG + Intergenic
1076047049 10:127302372-127302394 GGCCCCAGGAGTGGCCCCCCAGG - Intronic
1082811893 11:57483262-57483284 CGAGCCAGGAGCGGACCCGGGGG - Intergenic
1084218876 11:67665926-67665948 GGATCCAGGAGTGGCCAGGCTGG - Intronic
1090238824 11:125167341-125167363 CGACCCACGAGTGGCCTCGGCGG + Intronic
1094107709 12:26832116-26832138 CGAACCAGGACTCGCCCCACTGG - Intronic
1101986453 12:109451096-109451118 GGAACCAGGAGTGGACCTGCTGG + Exonic
1104592029 12:130092451-130092473 GGAGCCAGGGGTGGCCCAGCAGG + Intergenic
1104772021 12:131369448-131369470 AGCTCCAGGCCTGGCCCCGCTGG - Intergenic
1106134258 13:26962391-26962413 AAATCCAGGAGAGGCCCTGCAGG + Intergenic
1127867578 15:63044189-63044211 TGACCCCGGAGTGGCCACGCAGG - Intronic
1138544479 16:57707495-57707517 GGACCCAGGAGTGCACCCGCAGG - Exonic
1142623647 17:1179682-1179704 CGATCCAGGACAGGCGCGGCAGG + Exonic
1146739114 17:35265789-35265811 CAATCCAGGAGTAGCCCCACCGG + Exonic
1148135630 17:45290025-45290047 CGCCCCAGGACTGGCCCAGCAGG + Intronic
1148755775 17:49972267-49972289 CGATCCAGGAGTGGCCCCGCCGG + Intronic
1152627975 17:81396942-81396964 AGCTCCAGGAGAGGCCGCGCCGG - Intronic
1162489986 19:10986274-10986296 CGGGCCAGGAGGTGCCCCGCTGG + Exonic
1165342467 19:35222798-35222820 TGCTCCATGAGTGGCCCAGCAGG + Intergenic
1166046391 19:40233228-40233250 GGAACCAGGAGTGGCCGGGCTGG - Exonic
1167773461 19:51538354-51538376 CGAACCAGGAGTGCTCCTGCAGG - Intergenic
926319548 2:11739345-11739367 GAATCCAGGAGTGGCCCAGCTGG - Intronic
932727051 2:74188508-74188530 CAAGCCAGGTGTGGCCCAGCTGG + Intergenic
938133727 2:128737187-128737209 GGTTCCAGGAGTGGCCCGGAAGG - Intergenic
941978650 2:171432110-171432132 CAAGCCAGGAGTGGCCCAGTGGG + Intronic
947119235 2:226799120-226799142 CGCTCCTGGAGGGGCACCGCAGG - Exonic
1174452473 20:50628797-50628819 AGATCCTGGAGTGTCCCAGCTGG - Intronic
1176026737 20:62989821-62989843 CGTTCCCGGGGTGGCCCGGCTGG + Intergenic
1176026749 20:62989860-62989882 CGTTCCCGGGGTGGCCCGGCTGG + Intergenic
1176026761 20:62989899-62989921 CGTTCCCGGGGTGGCCCGGCTGG + Intergenic
1176026773 20:62989938-62989960 CGTTCCCGGGGTGGCCCGGCTGG + Intergenic
1176026785 20:62989977-62989999 CGTTCCCGGGGTGGCCCGGCTGG + Intergenic
1176026797 20:62990016-62990038 CGTTCCCGGGGTGGCCCGGCTGG + Intergenic
1176026821 20:62990094-62990116 CGTTCCCGGGGTGGCCCGGCTGG + Intergenic
1176026833 20:62990133-62990155 CGTTCCCGGGGTGGCCCGGCTGG + Intergenic
1176026845 20:62990172-62990194 CGTTCCCGGGGTGGCCCGGCTGG + Intergenic
1176026857 20:62990211-62990233 CGTTCCTGGGGTGGCCCGGCTGG + Intergenic
1181459297 22:23076816-23076838 AGATCAAGGAGTGGCCTCTCAGG + Intronic
1183725848 22:39589316-39589338 GCACCCAGGAGTGGCCCCGCTGG + Intronic
950315431 3:11997949-11997971 CAATCCAGGAGTGGCCAGGCAGG + Intergenic
950497168 3:13340705-13340727 GGAGCCAGGGGTGGCCCCACAGG + Intronic
952896685 3:38082466-38082488 CGAACCGGGACGGGCCCCGCGGG - Intronic
957631068 3:82716150-82716172 CGAGCCAGCAGTGGCAACGCTGG + Intergenic
964570252 3:158102901-158102923 GGATGCACGTGTGGCCCCGCTGG - Intronic
968461939 4:730547-730569 CGAGCCAGGCTTGGCACCGCGGG + Intronic
973821346 4:54664397-54664419 TGACCCAGGAGTGGCCCCCCAGG + Intronic
984370948 4:178863734-178863756 CAAACCAGGCGTGGCCCAGCAGG - Intergenic
987087325 5:14483188-14483210 GGCTCCAGGAATGGCCCAGCTGG + Intronic
1001396238 5:171420993-171421015 CCATCCGGGAGCGGCCTCGCGGG - Intronic
1001398743 5:171434329-171434351 CGATCCTGGACTGGGCCCACAGG - Intronic
1001526995 5:172436243-172436265 GGATCCTGGAGAGGCCCCGTGGG + Intronic
1001690691 5:173630419-173630441 AGATCCAGGAGTGGCCAAACTGG + Intergenic
1002259683 5:177984616-177984638 GGGTGCAGGAGGGGCCCCGCGGG + Intergenic
1006514751 6:34539588-34539610 GGACCCAGGAGAGGCCCCGAGGG + Intronic
1007243880 6:40446198-40446220 GGATTCAGGAGTGGCCAGGCTGG - Intronic
1007340888 6:41191021-41191043 CCATCCTGAAGTGGCCCCTCTGG + Exonic
1012729817 6:102867625-102867647 ACATCCAGTAGTGGCCCTGCAGG + Intergenic
1013793357 6:113859156-113859178 CGAGCCAGGAGCGCCCGCGCGGG - Intronic
1024533173 7:50409842-50409864 AGCTCCAGGAGTGGCCCTGCAGG + Intergenic
1026068221 7:67094785-67094807 AGATCCAGGAGTGGCCAACCTGG + Intronic
1026708700 7:72717529-72717551 AGATCCAGGAGTGGCCAACCCGG - Intronic
1027608951 7:80335278-80335300 CAATCCAGGATTTGCCCCTCTGG - Intergenic
1049203085 8:141351289-141351311 CCCTCCAGGAGAGGCCCAGCTGG + Intergenic
1053475103 9:38377107-38377129 GGATCCAGGAGTGGCTTAGCTGG + Intergenic
1056773814 9:89497707-89497729 CGTCCCAGGAGGGGCCCCGGGGG + Intronic
1057791557 9:98128180-98128202 CGGCCCAGGAGTGGCTCAGCGGG - Exonic
1061144154 9:128787399-128787421 CTGGCCAGGAGTGGCCCAGCCGG - Intronic
1061859104 9:133459096-133459118 GGGTCCAGTACTGGCCCCGCAGG - Exonic
1061942219 9:133889936-133889958 CATCCCAGGAGTGGCCCTGCGGG - Intronic
1185576812 X:1181027-1181049 TTATCCAGGTGTGGCCCGGCAGG + Intergenic
1185892781 X:3835539-3835561 CGTTGCACGTGTGGCCCCGCTGG - Intronic
1185897889 X:3873959-3873981 CGTTGCACGTGTGGCCCCGCTGG - Intergenic
1185903008 X:3912390-3912412 CGTTGCACGTGTGGCCCCGCTGG - Intergenic
1189337022 X:40176367-40176389 CCCTCCCGGAGTAGCCCCGCGGG + Intronic
1189848545 X:45157839-45157861 CGATCCAGGAGTCGCTGCGAAGG + Exonic
1195722203 X:107877927-107877949 CAATGGAGGAGTGGCCCCGCTGG - Intronic
1199431878 X:147770963-147770985 AAATCCAGGAGTGGCCAAGCTGG - Intergenic
1200235711 X:154466863-154466885 GGCTCCAGGAGGGGCCCCACCGG - Intronic