ID: 1148755776

View in Genome Browser
Species Human (GRCh38)
Location 17:49972268-49972290
Sequence GATCCAGGAGTGGCCCCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755771_1148755776 -3 Left 1148755771 17:49972248-49972270 CCGCGGCGGCACCGCAGCGCGAT 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1148755764_1148755776 16 Left 1148755764 17:49972229-49972251 CCAGAGCTGACCAGATCCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1148755768_1148755776 0 Left 1148755768 17:49972245-49972267 CCCCCGCGGCGGCACCGCAGCGC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1148755767_1148755776 6 Left 1148755767 17:49972239-49972261 CCAGATCCCCCGCGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1148755770_1148755776 -2 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107
1148755769_1148755776 -1 Left 1148755769 17:49972246-49972268 CCCCGCGGCGGCACCGCAGCGCG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 11
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755776 Original CRISPR GATCCAGGAGTGGCCCCGCC GGG Intronic
901318856 1:8327053-8327075 GATCCAGCTGAGGCCCCGCAGGG - Intronic
901514406 1:9735277-9735299 GTTCCTGGAGTGGCCCCGGCAGG - Intronic
905304817 1:37010192-37010214 GAGCAAGGAGTGGCCCGGCTTGG - Intronic
915954322 1:160209923-160209945 GGCCCAGCAGTGGCCCTGCCAGG - Intronic
922999147 1:229991794-229991816 GATTCAGGAGTAGCTCAGCCAGG + Intergenic
1062989757 10:1804442-1804464 GAAACAGAAGTGGCCCGGCCTGG - Intergenic
1063274673 10:4552542-4552564 GCTTCAGGAGTGTCCCCGCCAGG - Intergenic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1065298823 10:24302313-24302335 AATCCAGGAGTGGCCAACCCAGG - Intronic
1072462342 10:95631194-95631216 GAGCCAAGAGTGGCCCCTCCAGG + Intronic
1072810936 10:98461247-98461269 GATCCAGGCCTGGCCCCACATGG + Intronic
1075732919 10:124646952-124646974 TACCCAGGAATGGCCCGGCCAGG - Intronic
1076047048 10:127302371-127302393 GCCCCAGGAGTGGCCCCCCAGGG - Intronic
1083593465 11:63908317-63908339 GAGCCAGCACTGGCCCTGCCCGG + Intronic
1083705424 11:64510928-64510950 GACCCTGGAGAGGCACCGCCTGG + Intergenic
1083889908 11:65590521-65590543 GATCCAGGAGTGGTTCACCCTGG + Exonic
1083946438 11:65925687-65925709 AACCCAGGAGTGGACCTGCCAGG - Intergenic
1085339522 11:75722136-75722158 GACCCAGGAGTGGGCCCTGCAGG - Intronic
1096100892 12:48969971-48969993 ATTCCAGGAGAGGCCCCTCCCGG + Intronic
1101986454 12:109451097-109451119 GAACCAGGAGTGGACCTGCTGGG + Exonic
1103152716 12:118655307-118655329 AATCCAGGAGTGGCTTCTCCAGG - Intergenic
1103471355 12:121184420-121184442 GATCCAGGGATAGCCCCGTCTGG + Exonic
1103571344 12:121847036-121847058 GATCCAGGTGAGGCCGCCCCTGG - Exonic
1104505502 12:129328078-129328100 GCTCCAGGAAGGGCCCAGCCTGG - Intronic
1104592030 12:130092452-130092474 GAGCCAGGGGTGGCCCAGCAGGG + Intergenic
1104954361 12:132457231-132457253 GCCCCAGGAGTGGCCCGTCCGGG - Intergenic
1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1105772794 13:23629269-23629291 GAACCAGGAGTAGCCCTCCCTGG + Intronic
1115532777 14:34342447-34342469 GATCCAGGAGTGGCCTAGAAAGG - Intronic
1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG + Intergenic
1128570798 15:68731454-68731476 GAGATAGGAGTGGCCCAGCCTGG + Intergenic
1129393805 15:75233681-75233703 GGTCCAGGTGGGGCCCTGCCTGG + Intergenic
1131063165 15:89416857-89416879 CAGCCCGGAGTGTCCCCGCCAGG - Intergenic
1131133189 15:89912942-89912964 GATCCGGGAATGGCGCGGCCCGG + Exonic
1133236610 16:4390195-4390217 GACCCAGGAGAGCCCCAGCCTGG + Intronic
1133306775 16:4814614-4814636 CATCCAGGAGGGGGCCCGTCTGG - Exonic
1138360759 16:56425460-56425482 CAGCCAGGAGCGGCCCGGCCCGG - Exonic
1142976516 17:3647922-3647944 GAAGCAGGAGTGGCCACGTCGGG + Intronic
1143001741 17:3799021-3799043 AATCCAGGACTGGCCTGGCCTGG - Intronic
1145311361 17:21702724-21702746 GTTCCAGGAGCCGCCCTGCCTGG + Exonic
1145909627 17:28534949-28534971 GGTCCAGGAGGGGCCAGGCCTGG - Exonic
1147744497 17:42687015-42687037 GATCCGGGAATGGCGCCGCACGG - Exonic
1148469770 17:47885663-47885685 GCTCCAGGAGTGGGCCGGGCTGG + Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1151416989 17:73973018-73973040 GATTCAGGAGAGGTCCAGCCAGG - Intergenic
1152695480 17:81741754-81741776 GACCCGGGTGTGGCCGCGCCTGG - Intergenic
1160149388 18:76387742-76387764 GATTCAGGAATGGCCACTCCTGG - Intronic
1161066503 19:2241093-2241115 GGTCCAGGAGAGGCCACGACAGG + Intronic
1161531487 19:4792556-4792578 CATCCAGGAGCAGCCCGGCCAGG + Exonic
1162520109 19:11174650-11174672 GCTGCAGGAGTGGCTGCGCCTGG - Exonic
1163288621 19:16364583-16364605 GGACCAGGAGTGGCCCTGCATGG - Intronic
1163554174 19:17983208-17983230 GAGGCAGGAGGGGCTCCGCCAGG + Intronic
1164879102 19:31715688-31715710 CAGCCAGGAGGAGCCCCGCCAGG + Intergenic
1166046390 19:40233227-40233249 GAACCAGGAGTGGCCGGGCTGGG - Exonic
1166326282 19:42053058-42053080 AATGCAGGAGTGGCACCCCCAGG + Intronic
1167743649 19:51339043-51339065 GAGGCAGCAGGGGCCCCGCCGGG + Exonic
933559276 2:83872071-83872093 GATCCAGGAGTGGCCAACCCAGG + Intergenic
935216973 2:100982335-100982357 GATCCAGGAGCAGCTCTGCCTGG + Exonic
937915168 2:127095381-127095403 GATCCACCAGTGACCCCGCCAGG - Intronic
948205793 2:236162267-236162289 GAGCAGGGAGTGGCCCCCCCAGG - Intergenic
1170665741 20:18384649-18384671 GGACCAGGAGGGGCCCAGCCTGG - Intronic
1174332343 20:49830342-49830364 CATCTAGGAGGGGGCCCGCCTGG + Intronic
1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG + Intergenic
1176416014 21:6475191-6475213 AAGCCAGGAGTGGCCCCTCATGG - Intergenic
1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1176832784 21:13763027-13763049 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1179691514 21:43083525-43083547 AAGCCAGGAGTGGCCCCTCATGG - Intergenic
1179708029 21:43193813-43193835 GAACCAGGAGGGGCCTCGCCAGG - Intergenic
1181046652 22:20217799-20217821 GCTCCAGGAGTGGACCCACATGG + Intergenic
1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG + Intergenic
1183439194 22:37813606-37813628 GACCCAGGCGTCGCCCCACCTGG - Exonic
1183725849 22:39589317-39589339 CACCCAGGAGTGGCCCCGCTGGG + Intronic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1184838162 22:47036339-47036361 CCTCCAGGAGTGACACCGCCAGG + Intronic
950665742 3:14493769-14493791 CGGCCAGGAGTGGCACCGCCAGG + Exonic
953268476 3:41416391-41416413 GACCCAGGAGAGTCCCTGCCAGG - Intronic
960947693 3:122978184-122978206 GAACCAGGCCTGGCCCCACCTGG + Intronic
962249040 3:133823716-133823738 CATCCCTGAGTGGCCCCTCCAGG - Intronic
964570251 3:158102900-158102922 GATGCACGTGTGGCCCCGCTGGG - Intronic
966864528 3:184249897-184249919 AATCCCGGCGCGGCCCCGCCAGG + Intronic
969165210 4:5303195-5303217 GATCCAGCAATGCCCCCTCCTGG - Intronic
969198706 4:5584622-5584644 GATCCTGGAGTCGCACAGCCGGG - Exonic
970057273 4:11989040-11989062 GATCCAGAAGGGGCCCTGTCTGG + Intergenic
973222914 4:47749578-47749600 TATCTGGGAGTGGCCCAGCCAGG - Intronic
985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG + Intronic
986557960 5:9030345-9030367 AATCCAGGAGTCGCCTCACCAGG + Intergenic
996980784 5:129491290-129491312 CACTCAGGAGTGGCCCGGCCTGG - Intronic
999261195 5:150239917-150239939 GGACGAGGACTGGCCCCGCCAGG - Intronic
999382040 5:151128112-151128134 GAGCCAGGAGAGTCCCCGCCTGG + Intronic
1004271476 6:14199948-14199970 GATCTAGGAGTGGCTCCTCTAGG - Intergenic
1006021327 6:31119448-31119470 GGTCCAGGGGTTGCCCGGCCTGG + Intronic
1007727187 6:43923696-43923718 GGTCTGGGAGTGGCCCAGCCAGG + Intergenic
1010914152 6:81595129-81595151 GACCCAGGTGTGACCCCGGCTGG + Intronic
1013667879 6:112366713-112366735 CATCCAGGAGCAGCCCAGCCAGG - Intergenic
1017981080 6:159401643-159401665 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1019346276 7:532264-532286 GACACAGGAGTTCCCCCGCCTGG - Intergenic
1023112385 7:36826778-36826800 GATCCAGGACTGGCCAAGCAAGG - Intergenic
1023845044 7:44115802-44115824 GATCCTGGAGTGGACCCTGCGGG - Exonic
1024589667 7:50870354-50870376 GGTCCAGGAATGGCCCCCCATGG - Intergenic
1026068222 7:67094786-67094808 GATCCAGGAGTGGCCAACCTGGG + Intronic
1026708699 7:72717528-72717550 GATCCAGGAGTGGCCAACCCGGG - Intronic
1030715144 7:112800704-112800726 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1032016164 7:128381588-128381610 CAACCAGCAGTGACCCCGCCTGG - Intergenic
1032020548 7:128405338-128405360 GCCCCAGGAGAGGCCCAGCCAGG - Intronic
1035195953 7:157220667-157220689 GAACCAGGATTGCCCCCGACAGG + Exonic
1035674083 8:1442552-1442574 GATCCGGGCGTAGACCCGCCAGG + Intergenic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1045264128 8:100604547-100604569 GATGCAGGACTAGCCCCACCTGG + Intronic
1046021661 8:108672548-108672570 GATTCAAGAGTGGCCCAGGCCGG - Intronic
1049680048 8:143914081-143914103 GGAACAGGAGTGGCCCCGGCCGG - Intergenic
1051663275 9:19445104-19445126 GACCCAGGAGTGGTCCCCTCCGG + Intronic
1057143908 9:92745820-92745842 GATCCAGAAGTGGCTGGGCCTGG + Intronic
1061089872 9:128420631-128420653 GACCCTGGAGCAGCCCCGCCCGG - Exonic
1061144153 9:128787398-128787420 TGGCCAGGAGTGGCCCAGCCGGG - Intronic
1061799011 9:133104124-133104146 GATCCAGGTGTGGCTCTGCTAGG + Intronic
1185480112 X:439437-439459 GAACCCTGAGTGGCCCAGCCTGG - Intergenic
1185576813 X:1181028-1181050 TATCCAGGTGTGGCCCGGCAGGG + Intergenic
1188104426 X:26132357-26132379 GAACTAAGAATGGCCCCGCCTGG + Intergenic
1195936066 X:110126794-110126816 CACACAGGAGTGGCCCAGCCAGG - Intronic