ID: 1148755777

View in Genome Browser
Species Human (GRCh38)
Location 17:49972271-49972293
Sequence TAGCCCGGCGGGGCCACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755777_1148755787 20 Left 1148755777 17:49972271-49972293 CCAGGAGTGGCCCCGCCGGGCTA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1148755787 17:49972314-49972336 CGGGTCACCTTCCCTGCCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1148755777_1148755783 0 Left 1148755777 17:49972271-49972293 CCAGGAGTGGCCCCGCCGGGCTA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1148755783 17:49972294-49972316 CGCTGCGCGCTCTTGGAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1148755777_1148755784 1 Left 1148755777 17:49972271-49972293 CCAGGAGTGGCCCCGCCGGGCTA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1148755784 17:49972295-49972317 GCTGCGCGCTCTTGGAACCCGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1148755777_1148755782 -7 Left 1148755777 17:49972271-49972293 CCAGGAGTGGCCCCGCCGGGCTA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755777 Original CRISPR TAGCCCGGCGGGGCCACTCC TGG (reversed) Intronic