ID: 1148755777 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:49972271-49972293 |
| Sequence | TAGCCCGGCGGGGCCACTCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 77 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 70} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1148755777_1148755782 | -7 | Left | 1148755777 | 17:49972271-49972293 | CCAGGAGTGGCCCCGCCGGGCTA | 0: 1 1: 0 2: 0 3: 6 4: 70 |
||
| Right | 1148755782 | 17:49972287-49972309 | CGGGCTACGCTGCGCGCTCTTGG | 0: 1 1: 0 2: 0 3: 2 4: 38 |
||||
| 1148755777_1148755783 | 0 | Left | 1148755777 | 17:49972271-49972293 | CCAGGAGTGGCCCCGCCGGGCTA | 0: 1 1: 0 2: 0 3: 6 4: 70 |
||
| Right | 1148755783 | 17:49972294-49972316 | CGCTGCGCGCTCTTGGAACCCGG | 0: 1 1: 0 2: 0 3: 2 4: 44 |
||||
| 1148755777_1148755784 | 1 | Left | 1148755777 | 17:49972271-49972293 | CCAGGAGTGGCCCCGCCGGGCTA | 0: 1 1: 0 2: 0 3: 6 4: 70 |
||
| Right | 1148755784 | 17:49972295-49972317 | GCTGCGCGCTCTTGGAACCCGGG | 0: 1 1: 0 2: 0 3: 5 4: 73 |
||||
| 1148755777_1148755787 | 20 | Left | 1148755777 | 17:49972271-49972293 | CCAGGAGTGGCCCCGCCGGGCTA | 0: 1 1: 0 2: 0 3: 6 4: 70 |
||
| Right | 1148755787 | 17:49972314-49972336 | CGGGTCACCTTCCCTGCCGCCGG | 0: 1 1: 0 2: 0 3: 8 4: 113 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1148755777 | Original CRISPR | TAGCCCGGCGGGGCCACTCC TGG (reversed) | Intronic | ||