ID: 1148755778

View in Genome Browser
Species Human (GRCh38)
Location 17:49972281-49972303
Sequence GCGCGCAGCGTAGCCCGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755778_1148755783 -10 Left 1148755778 17:49972281-49972303 CCCCGCCGGGCTACGCTGCGCGC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1148755783 17:49972294-49972316 CGCTGCGCGCTCTTGGAACCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1148755778_1148755787 10 Left 1148755778 17:49972281-49972303 CCCCGCCGGGCTACGCTGCGCGC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1148755787 17:49972314-49972336 CGGGTCACCTTCCCTGCCGCCGG 0: 1
1: 0
2: 0
3: 8
4: 113
1148755778_1148755784 -9 Left 1148755778 17:49972281-49972303 CCCCGCCGGGCTACGCTGCGCGC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1148755784 17:49972295-49972317 GCTGCGCGCTCTTGGAACCCGGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755778 Original CRISPR GCGCGCAGCGTAGCCCGGCG GGG (reversed) Intronic