ID: 1148755778 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:49972281-49972303 |
Sequence | GCGCGCAGCGTAGCCCGGCG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 91 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 85} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1148755778_1148755783 | -10 | Left | 1148755778 | 17:49972281-49972303 | CCCCGCCGGGCTACGCTGCGCGC | 0: 1 1: 0 2: 0 3: 5 4: 85 |
||
Right | 1148755783 | 17:49972294-49972316 | CGCTGCGCGCTCTTGGAACCCGG | 0: 1 1: 0 2: 0 3: 2 4: 44 |
||||
1148755778_1148755784 | -9 | Left | 1148755778 | 17:49972281-49972303 | CCCCGCCGGGCTACGCTGCGCGC | 0: 1 1: 0 2: 0 3: 5 4: 85 |
||
Right | 1148755784 | 17:49972295-49972317 | GCTGCGCGCTCTTGGAACCCGGG | 0: 1 1: 0 2: 0 3: 5 4: 73 |
||||
1148755778_1148755787 | 10 | Left | 1148755778 | 17:49972281-49972303 | CCCCGCCGGGCTACGCTGCGCGC | 0: 1 1: 0 2: 0 3: 5 4: 85 |
||
Right | 1148755787 | 17:49972314-49972336 | CGGGTCACCTTCCCTGCCGCCGG | 0: 1 1: 0 2: 0 3: 8 4: 113 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1148755778 | Original CRISPR | GCGCGCAGCGTAGCCCGGCG GGG (reversed) | Intronic | ||