ID: 1148755779 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:49972282-49972304 |
| Sequence | AGCGCGCAGCGTAGCCCGGC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 63 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 59} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1148755779_1148755787 | 9 | Left | 1148755779 | 17:49972282-49972304 | CCCGCCGGGCTACGCTGCGCGCT | 0: 1 1: 0 2: 0 3: 3 4: 59 |
||
| Right | 1148755787 | 17:49972314-49972336 | CGGGTCACCTTCCCTGCCGCCGG | 0: 1 1: 0 2: 0 3: 8 4: 113 |
||||
| 1148755779_1148755784 | -10 | Left | 1148755779 | 17:49972282-49972304 | CCCGCCGGGCTACGCTGCGCGCT | 0: 1 1: 0 2: 0 3: 3 4: 59 |
||
| Right | 1148755784 | 17:49972295-49972317 | GCTGCGCGCTCTTGGAACCCGGG | 0: 1 1: 0 2: 0 3: 5 4: 73 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1148755779 | Original CRISPR | AGCGCGCAGCGTAGCCCGGC GGG (reversed) | Intronic | ||