ID: 1148755780 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:49972283-49972305 |
| Sequence | GAGCGCGCAGCGTAGCCCGG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 59 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 56} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1148755780_1148755787 | 8 | Left | 1148755780 | 17:49972283-49972305 | CCGCCGGGCTACGCTGCGCGCTC | 0: 1 1: 0 2: 0 3: 2 4: 56 |
||
| Right | 1148755787 | 17:49972314-49972336 | CGGGTCACCTTCCCTGCCGCCGG | 0: 1 1: 0 2: 0 3: 8 4: 113 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1148755780 | Original CRISPR | GAGCGCGCAGCGTAGCCCGG CGG (reversed) | Intronic | ||