ID: 1148755781 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:49972286-49972308 |
Sequence | CAAGAGCGCGCAGCGTAGCC CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 31 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 27} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1148755781_1148755787 | 5 | Left | 1148755781 | 17:49972286-49972308 | CCGGGCTACGCTGCGCGCTCTTG | 0: 1 1: 0 2: 0 3: 3 4: 27 |
||
Right | 1148755787 | 17:49972314-49972336 | CGGGTCACCTTCCCTGCCGCCGG | 0: 1 1: 0 2: 0 3: 8 4: 113 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1148755781 | Original CRISPR | CAAGAGCGCGCAGCGTAGCC CGG (reversed) | Intronic | ||