ID: 1148755782

View in Genome Browser
Species Human (GRCh38)
Location 17:49972287-49972309
Sequence CGGGCTACGCTGCGCGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148755774_1148755782 5 Left 1148755774 17:49972259-49972281 CCGCAGCGCGATCCAGGAGTGGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1148755767_1148755782 25 Left 1148755767 17:49972239-49972261 CCAGATCCCCCGCGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1148755769_1148755782 18 Left 1148755769 17:49972246-49972268 CCCCGCGGCGGCACCGCAGCGCG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1148755770_1148755782 17 Left 1148755770 17:49972247-49972269 CCCGCGGCGGCACCGCAGCGCGA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1148755771_1148755782 16 Left 1148755771 17:49972248-49972270 CCGCGGCGGCACCGCAGCGCGAT 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1148755768_1148755782 19 Left 1148755768 17:49972245-49972267 CCCCCGCGGCGGCACCGCAGCGC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
1148755777_1148755782 -7 Left 1148755777 17:49972271-49972293 CCAGGAGTGGCCCCGCCGGGCTA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148755782 Original CRISPR CGGGCTACGCTGCGCGCTCT TGG Intronic
915169760 1:153969414-153969436 GGGGCTACGGTGCCTGCTCTGGG - Exonic
922705399 1:227787918-227787940 AGGGCTACGCTGCGTGGACTAGG + Intergenic
1084431433 11:69113644-69113666 CGGGCTTCGCTGGGCATTCTAGG - Intergenic
1089289157 11:117427390-117427412 CTGGCTACCCTGCACTCTCTTGG + Intergenic
1092125484 12:6072302-6072324 GGGGCTGCGCAGCGTGCTCTGGG - Intronic
1097990398 12:65826107-65826129 CTGGCTACCCTGCACTCTCTTGG - Intronic
1102101330 12:110281161-110281183 CGCGCCGCGCTGGGCGCTCTCGG + Intronic
1107481525 13:40789613-40789635 CAGGCTCCGCCGCCCGCTCTCGG - Exonic
1119808600 14:77498613-77498635 CGGGCTGCGGAGCGCGCTGTCGG - Intronic
1122144923 14:99683629-99683651 CCGGCCACGCCGTGCGCTCTCGG + Intergenic
1122904531 14:104795692-104795714 CGGGCCGCGCTGCGTGCGCTGGG + Intronic
1148755782 17:49972287-49972309 CGGGCTACGCTGCGCGCTCTTGG + Intronic
1155654548 18:28177903-28177925 CGGCCTCCGCTGCGCGACCTGGG + Intergenic
1163782547 19:19258001-19258023 CGGCCTCCGCAGCGCGCTCGCGG + Exonic
937083674 2:119157475-119157497 CGGGCTACCCTGCGAGCCCCGGG - Intronic
938066103 2:128282831-128282853 CGGGCTGGGCTGTGCGCCCTGGG - Intronic
947632409 2:231662629-231662651 TGGGCAACGCTGCAAGCTCTAGG - Intergenic
1169116986 20:3072238-3072260 CGGGGGCCGCTGCGCGGTCTTGG + Exonic
1175918386 20:62438249-62438271 CGGCCTGCGCTGCCTGCTCTCGG + Intergenic
1183981648 22:41544104-41544126 CGGCCTGCGCTGGGGGCTCTGGG + Exonic
949289519 3:2448166-2448188 CAGGCTTCGCTGCCTGCTCTGGG - Intronic
954256479 3:49411454-49411476 CCGGCTACACTGCGCGGTCGCGG + Intronic
983620635 4:169757787-169757809 CGGGCTACGCGGGGCGCTTTGGG - Intronic
986330294 5:6712828-6712850 CAGGTCACGCTGCGCTCTCTGGG - Intergenic
989379214 5:40797739-40797761 CGGGCGGCGCGGCGCGCTCTGGG - Intronic
1002381297 5:178831771-178831793 AGGGCTACGCTGCTGGCACTAGG - Intergenic
1006472640 6:34237280-34237302 CGGCCTGCGGTGCGCGCTCCGGG - Exonic
1011685420 6:89819803-89819825 ACGGCTACGCTGCGCCCTCCCGG + Intergenic
1015519443 6:134115531-134115553 GTGGCTGCGCTGCGCGCTGTGGG + Intergenic
1017073757 6:150599937-150599959 CGGGCTGCGCTGCGCCGGCTCGG - Exonic
1018704876 6:166456503-166456525 CGGGCTAAGCAGCATGCTCTAGG + Intronic
1019515730 7:1439070-1439092 CGGGCTACCCAGCGAGCTGTTGG - Intronic
1020110275 7:5443893-5443915 CGGGCCACGCTTGGCGCTCCTGG - Intronic
1033683675 7:143620564-143620586 CGGGCCGTGCTGCGGGCTCTCGG - Intergenic
1033700937 7:143837074-143837096 CGGGCCGTGCTGCGGGCTCTCGG + Intergenic
1035170889 7:157016941-157016963 CCGGCTAAGCAGCGGGCTCTTGG - Intergenic
1035580861 8:738313-738335 CGGGCTGGGCTGCGCGCACGGGG + Intergenic
1061620210 9:131807109-131807131 CAGGCTACTCTGCTCTCTCTCGG - Intergenic
1062272146 9:135714479-135714501 CGGGCTGCGCTGCGCGGGCCGGG + Intronic
1187399870 X:18950198-18950220 CGGGCTGCTCAGCCCGCTCTGGG + Intronic
1198496365 X:137197464-137197486 GGGGCTGCGCTGCGGACTCTGGG + Intergenic